ID: 979159291

View in Genome Browser
Species Human (GRCh38)
Location 4:117438468-117438490
Sequence CTCTCCCAACACCTGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979159285_979159291 29 Left 979159285 4:117438416-117438438 CCAGAAAAGGTATAGAAACAATT No data
Right 979159291 4:117438468-117438490 CTCTCCCAACACCTGGATTTTGG No data
979159288_979159291 4 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159291 4:117438468-117438490 CTCTCCCAACACCTGGATTTTGG No data
979159289_979159291 -5 Left 979159289 4:117438450-117438472 CCTCTATAGGGAGTACAGCTCTC No data
Right 979159291 4:117438468-117438490 CTCTCCCAACACCTGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979159291 Original CRISPR CTCTCCCAACACCTGGATTT TGG Intergenic
No off target data available for this crispr