ID: 979159296

View in Genome Browser
Species Human (GRCh38)
Location 4:117438492-117438514
Sequence TATCTGGCCATCAGAACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979159292_979159296 -3 Left 979159292 4:117438472-117438494 CCCAACACCTGGATTTTGGATAT No data
Right 979159296 4:117438492-117438514 TATCTGGCCATCAGAACTATTGG No data
979159288_979159296 28 Left 979159288 4:117438441-117438463 CCTCTAGAGCCTCTATAGGGAGT No data
Right 979159296 4:117438492-117438514 TATCTGGCCATCAGAACTATTGG No data
979159295_979159296 -10 Left 979159295 4:117438479-117438501 CCTGGATTTTGGATATCTGGCCA No data
Right 979159296 4:117438492-117438514 TATCTGGCCATCAGAACTATTGG No data
979159293_979159296 -4 Left 979159293 4:117438473-117438495 CCAACACCTGGATTTTGGATATC No data
Right 979159296 4:117438492-117438514 TATCTGGCCATCAGAACTATTGG No data
979159289_979159296 19 Left 979159289 4:117438450-117438472 CCTCTATAGGGAGTACAGCTCTC No data
Right 979159296 4:117438492-117438514 TATCTGGCCATCAGAACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979159296 Original CRISPR TATCTGGCCATCAGAACTAT TGG Intergenic
No off target data available for this crispr