ID: 979169033

View in Genome Browser
Species Human (GRCh38)
Location 4:117576029-117576051
Sequence CGCCACCAGGGCGCACACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979169025_979169033 -10 Left 979169025 4:117576016-117576038 CCAGCACCACCCCCGCCACCAGG No data
Right 979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG No data
979169024_979169033 16 Left 979169024 4:117575990-117576012 CCTCTTCAAGGTGAATATGTACT No data
Right 979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG No data
979169021_979169033 25 Left 979169021 4:117575981-117576003 CCCCGTCTTCCTCTTCAAGGTGA No data
Right 979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG No data
979169023_979169033 23 Left 979169023 4:117575983-117576005 CCGTCTTCCTCTTCAAGGTGAAT No data
Right 979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG No data
979169022_979169033 24 Left 979169022 4:117575982-117576004 CCCGTCTTCCTCTTCAAGGTGAA No data
Right 979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG No data
979169019_979169033 28 Left 979169019 4:117575978-117576000 CCGCCCCGTCTTCCTCTTCAAGG No data
Right 979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979169033 Original CRISPR CGCCACCAGGGCGCACACGC TGG Intergenic
No off target data available for this crispr