ID: 979177032

View in Genome Browser
Species Human (GRCh38)
Location 4:117678411-117678433
Sequence CTTTATTAGCAGTGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979177028_979177032 -6 Left 979177028 4:117678394-117678416 CCCAGTCTCAGATATGTCTTTAT No data
Right 979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG No data
979177027_979177032 14 Left 979177027 4:117678374-117678396 CCTCTTTCTTTTATAAATTGCCC No data
Right 979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG No data
979177029_979177032 -7 Left 979177029 4:117678395-117678417 CCAGTCTCAGATATGTCTTTATT No data
Right 979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979177032 Original CRISPR CTTTATTAGCAGTGGGAAAA TGG Intergenic
No off target data available for this crispr