ID: 979179241

View in Genome Browser
Species Human (GRCh38)
Location 4:117704789-117704811
Sequence AGGTGAGATAATGCCTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979179241_979179244 25 Left 979179241 4:117704789-117704811 CCACATGAGGCATTATCTCACCT No data
Right 979179244 4:117704837-117704859 AACAAACGCTATTGAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979179241 Original CRISPR AGGTGAGATAATGCCTCATG TGG (reversed) Intergenic
No off target data available for this crispr