ID: 979179242

View in Genome Browser
Species Human (GRCh38)
Location 4:117704809-117704831
Sequence TTGGTCTTTTTGATAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979179242_979179244 5 Left 979179242 4:117704809-117704831 CCTCAGTTTATCAAAAAGACCAA No data
Right 979179244 4:117704837-117704859 AACAAACGCTATTGAGAATGTGG No data
979179242_979179245 19 Left 979179242 4:117704809-117704831 CCTCAGTTTATCAAAAAGACCAA No data
Right 979179245 4:117704851-117704873 AGAATGTGGAGAAATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979179242 Original CRISPR TTGGTCTTTTTGATAAACTG AGG (reversed) Intergenic
No off target data available for this crispr