ID: 979179244

View in Genome Browser
Species Human (GRCh38)
Location 4:117704837-117704859
Sequence AACAAACGCTATTGAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979179242_979179244 5 Left 979179242 4:117704809-117704831 CCTCAGTTTATCAAAAAGACCAA No data
Right 979179244 4:117704837-117704859 AACAAACGCTATTGAGAATGTGG No data
979179241_979179244 25 Left 979179241 4:117704789-117704811 CCACATGAGGCATTATCTCACCT No data
Right 979179244 4:117704837-117704859 AACAAACGCTATTGAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979179244 Original CRISPR AACAAACGCTATTGAGAATG TGG Intergenic
No off target data available for this crispr