ID: 979180900

View in Genome Browser
Species Human (GRCh38)
Location 4:117725995-117726017
Sequence AACTACCCACAGATGTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979180898_979180900 11 Left 979180898 4:117725961-117725983 CCATTTTATTCTCATATTTGCCA No data
Right 979180900 4:117725995-117726017 AACTACCCACAGATGTACCAAGG No data
979180899_979180900 -9 Left 979180899 4:117725981-117726003 CCAAACATGTTTCAAACTACCCA No data
Right 979180900 4:117725995-117726017 AACTACCCACAGATGTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979180900 Original CRISPR AACTACCCACAGATGTACCA AGG Intergenic
No off target data available for this crispr