ID: 979184315

View in Genome Browser
Species Human (GRCh38)
Location 4:117770130-117770152
Sequence AATTCTAAGCAGAAAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979184311_979184315 6 Left 979184311 4:117770101-117770123 CCACTGTTGATAGGGACAGGAGG No data
Right 979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979184315 Original CRISPR AATTCTAAGCAGAAAAGGGC AGG Intergenic
No off target data available for this crispr