ID: 979184349

View in Genome Browser
Species Human (GRCh38)
Location 4:117770301-117770323
Sequence CAGGTTCAGCTGGCAGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979184333_979184349 9 Left 979184333 4:117770269-117770291 CCCTGCCCCCCATCCTGTGCCCA 0: 12
1: 63
2: 127
3: 307
4: 958
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184342_979184349 -10 Left 979184342 4:117770288-117770310 CCCATAAAAACCCCAGGTTCAGC 0: 4
1: 41
2: 231
3: 405
4: 695
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184332_979184349 12 Left 979184332 4:117770266-117770288 CCACCCTGCCCCCCATCCTGTGC No data
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184335_979184349 4 Left 979184335 4:117770274-117770296 CCCCCCATCCTGTGCCCATAAAA 0: 22
1: 118
2: 192
3: 267
4: 500
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184340_979184349 -4 Left 979184340 4:117770282-117770304 CCTGTGCCCATAAAAACCCCAGG 0: 41
1: 93
2: 212
3: 467
4: 765
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184338_979184349 1 Left 979184338 4:117770277-117770299 CCCATCCTGTGCCCATAAAAACC 0: 76
1: 353
2: 678
3: 863
4: 695
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184339_979184349 0 Left 979184339 4:117770278-117770300 CCATCCTGTGCCCATAAAAACCC 0: 49
1: 266
2: 563
3: 679
4: 764
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184334_979184349 8 Left 979184334 4:117770270-117770292 CCTGCCCCCCATCCTGTGCCCAT No data
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184336_979184349 3 Left 979184336 4:117770275-117770297 CCCCCATCCTGTGCCCATAAAAA 0: 53
1: 312
2: 549
3: 750
4: 919
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data
979184337_979184349 2 Left 979184337 4:117770276-117770298 CCCCATCCTGTGCCCATAAAAAC 0: 57
1: 343
2: 595
3: 782
4: 874
Right 979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979184349 Original CRISPR CAGGTTCAGCTGGCAGAGTA GGG Intergenic
No off target data available for this crispr