ID: 979188635

View in Genome Browser
Species Human (GRCh38)
Location 4:117831544-117831566
Sequence ACTATAGCACACGCACGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979188635_979188638 5 Left 979188635 4:117831544-117831566 CCCCAGCGTGCGTGTGCTATAGT No data
Right 979188638 4:117831572-117831594 CTTTCAGCTTTGCTGTCTGCAGG No data
979188635_979188639 8 Left 979188635 4:117831544-117831566 CCCCAGCGTGCGTGTGCTATAGT No data
Right 979188639 4:117831575-117831597 TCAGCTTTGCTGTCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979188635 Original CRISPR ACTATAGCACACGCACGCTG GGG (reversed) Intergenic
No off target data available for this crispr