ID: 979190218

View in Genome Browser
Species Human (GRCh38)
Location 4:117847980-117848002
Sequence CTGTATAATCTGAGTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979190212_979190218 -2 Left 979190212 4:117847959-117847981 CCCACTCCCTAGCATTAAGCACT No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data
979190209_979190218 7 Left 979190209 4:117847950-117847972 CCCATGATCCCCACTCCCTAGCA No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data
979190215_979190218 -9 Left 979190215 4:117847966-117847988 CCTAGCATTAAGCACTGTATAAT No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data
979190213_979190218 -3 Left 979190213 4:117847960-117847982 CCACTCCCTAGCATTAAGCACTG No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data
979190214_979190218 -8 Left 979190214 4:117847965-117847987 CCCTAGCATTAAGCACTGTATAA No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data
979190211_979190218 -1 Left 979190211 4:117847958-117847980 CCCCACTCCCTAGCATTAAGCAC No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data
979190210_979190218 6 Left 979190210 4:117847951-117847973 CCATGATCCCCACTCCCTAGCAT No data
Right 979190218 4:117847980-117848002 CTGTATAATCTGAGTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979190218 Original CRISPR CTGTATAATCTGAGTCTGGG TGG Intergenic
No off target data available for this crispr