ID: 979192033

View in Genome Browser
Species Human (GRCh38)
Location 4:117873513-117873535
Sequence GAGTTGCCATGGGCACCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979192030_979192033 -10 Left 979192030 4:117873500-117873522 CCAGTTGTCAGAAGAGTTGCCAT No data
Right 979192033 4:117873513-117873535 GAGTTGCCATGGGCACCATTAGG No data
979192029_979192033 -9 Left 979192029 4:117873499-117873521 CCCAGTTGTCAGAAGAGTTGCCA No data
Right 979192033 4:117873513-117873535 GAGTTGCCATGGGCACCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979192033 Original CRISPR GAGTTGCCATGGGCACCATT AGG Intergenic
No off target data available for this crispr