ID: 979192135

View in Genome Browser
Species Human (GRCh38)
Location 4:117874687-117874709
Sequence CTTTGTAAGTGGGAAGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979192135_979192139 8 Left 979192135 4:117874687-117874709 CCCTTTACTTCCCACTTACAAAG No data
Right 979192139 4:117874718-117874740 CTTCATATTAAAAGACTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979192135 Original CRISPR CTTTGTAAGTGGGAAGTAAA GGG (reversed) Intergenic
No off target data available for this crispr