ID: 979205954

View in Genome Browser
Species Human (GRCh38)
Location 4:118038251-118038273
Sequence CTGCCCTATATGACTTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979205954_979205958 -1 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205958 4:118038273-118038295 GAATAAACAGCAAACAGCAGTGG No data
979205954_979205962 30 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205962 4:118038304-118038326 TCTTCTCTTGCATCACTGGATGG No data
979205954_979205959 0 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 353
979205954_979205960 1 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205960 4:118038275-118038297 ATAAACAGCAAACAGCAGTGGGG 0: 1
1: 0
2: 3
3: 39
4: 360
979205954_979205961 26 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205961 4:118038300-118038322 GTTTTCTTCTCTTGCATCACTGG 0: 1
1: 0
2: 0
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979205954 Original CRISPR CTGCCCTATATGACTTAAGG GGG (reversed) Intronic
907751790 1:57269831-57269853 CTGCCATACATGATTTAGGGAGG - Intronic
907832440 1:58077825-58077847 CTGCCCTCTGAGACTTGAGGTGG - Intronic
908199733 1:61781890-61781912 CTGTCCTATATGACTCCATGGGG - Intronic
915732035 1:158060652-158060674 CTGCCCCATATGACTGATGAGGG - Intronic
916007136 1:160673109-160673131 CTGCCTCCTATCACTTAAGGAGG + Intergenic
920599533 1:207309670-207309692 CAACCTTATATGATTTAAGGAGG + Intergenic
921294975 1:213693010-213693032 CTGCCCTAAAGGGCTTAATGAGG + Intergenic
1074422221 10:113319442-113319464 CTGCCATAAATGACTTTGGGAGG - Intergenic
1078823660 11:14906597-14906619 CTGCCCAATATGGCTGAAGAAGG - Intronic
1087393237 11:97566269-97566291 CTGGCCTCCATGATTTAAGGTGG - Intergenic
1088605545 11:111526787-111526809 CTGCCCATAATGACTTAAGAAGG - Intronic
1090943125 11:131406145-131406167 CTGATCTTTAAGACTTAAGGTGG + Intronic
1093467831 12:19468294-19468316 CTGGCCTATCTGACTTTAGATGG + Intronic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1125114471 15:36073243-36073265 ATGACCTATATAAATTAAGGAGG - Intergenic
1129270942 15:74418939-74418961 CTGCCCTACATGGCCTGAGGAGG + Exonic
1129467703 15:75733129-75733151 CTGCCCTGGATGACCTGAGGAGG - Intergenic
1129719510 15:77870462-77870484 CTGCCCTGGATGACCTGAGGAGG + Intergenic
1130183030 15:81651183-81651205 CTGCCCTTTCTGACTTGGGGTGG + Intergenic
1148079658 17:44960623-44960645 AAGCCCTATAAGAGTTAAGGAGG - Intronic
1154293471 18:13130608-13130630 CTTCCCAGTATGACTTAAGAGGG + Intergenic
1155064177 18:22254556-22254578 CTGCCCCATAAGACTCCAGGGGG - Intergenic
1155306748 18:24486039-24486061 TTGCAGTATATGACTCAAGGTGG - Intergenic
1157391610 18:47307948-47307970 GTGGCCTCTAAGACTTAAGGTGG - Intergenic
1163927604 19:20360827-20360849 CTACCTCATATGACTTAGGGTGG + Intergenic
930232779 2:48859551-48859573 CTGCCCTCTATGAATTGGGGTGG - Intergenic
940132227 2:150395180-150395202 CTGAACTATATTACTTAATGAGG - Intergenic
940579031 2:155551845-155551867 ATGCCCTATATGATTTACTGAGG - Intergenic
941760481 2:169236669-169236691 CTTCCTTATATGACTTAAAAGGG + Intronic
942833306 2:180262746-180262768 CTTCCCTTTAGGACTTAAGGGGG + Intergenic
1169659576 20:7963598-7963620 CTCCCCTAAATAACTTAAGACGG + Intergenic
1178329471 21:31675220-31675242 AGGCCCTATATGCCATAAGGAGG + Intronic
951004802 3:17603490-17603512 CTACCCTATATGATTAAAAGGGG + Intronic
954238860 3:49277636-49277658 CTACCCTAGATGAATTAAGACGG - Exonic
970792305 4:19873122-19873144 CTGCCATATATGACTCAAGAAGG + Intergenic
974169986 4:58254223-58254245 CTGGCCTAAGTGACTTAAGATGG - Intergenic
978635216 4:110796500-110796522 CTGCCCTTTATTACATAAGTGGG + Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
984759199 4:183349163-183349185 TTGCCCTATATGGTCTAAGGGGG + Intergenic
985351132 4:189062326-189062348 CTGCCCATTCTGAATTAAGGAGG - Intergenic
988585675 5:32505515-32505537 CTGCACTATTTGTCTTTAGGAGG + Intergenic
989767278 5:45102534-45102556 CTTCCCTACATGACATAAGGTGG - Intergenic
994559038 5:101344371-101344393 CTGCCCTACATGAATTAGTGGGG + Intergenic
1004668545 6:17772828-17772850 CTGCTATATATGACTAAGGGAGG + Intronic
1007449885 6:41934887-41934909 CTGCACTGTATGAGGTAAGGAGG - Intergenic
1012034582 6:94116953-94116975 CTGCCATTTATGACTCAATGGGG - Intergenic
1042463411 8:69097820-69097842 CTGCTCTTTATGGCTTAATGGGG - Intergenic
1043302410 8:78750209-78750231 CTGCCCTGTACCACCTAAGGAGG + Intronic
1056050045 9:82758751-82758773 GTACCCTAAATCACTTAAGGAGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1189601473 X:42631020-42631042 CTGCCATATTTGAGTTGAGGTGG + Intergenic
1191890228 X:65932030-65932052 CTACCTCATATGGCTTAAGGTGG - Intergenic
1194031460 X:88821350-88821372 TGGCCTTATATGAGTTAAGGAGG + Intergenic