ID: 979205958

View in Genome Browser
Species Human (GRCh38)
Location 4:118038273-118038295
Sequence GAATAAACAGCAAACAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979205951_979205958 29 Left 979205951 4:118038221-118038243 CCAATCTTAGAGGGTAAAGGCAG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 979205958 4:118038273-118038295 GAATAAACAGCAAACAGCAGTGG No data
979205955_979205958 -2 Left 979205955 4:118038252-118038274 CCCCTTAAGTCATATAGGGCAGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 979205958 4:118038273-118038295 GAATAAACAGCAAACAGCAGTGG No data
979205956_979205958 -3 Left 979205956 4:118038253-118038275 CCCTTAAGTCATATAGGGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 127
Right 979205958 4:118038273-118038295 GAATAAACAGCAAACAGCAGTGG No data
979205954_979205958 -1 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205958 4:118038273-118038295 GAATAAACAGCAAACAGCAGTGG No data
979205957_979205958 -4 Left 979205957 4:118038254-118038276 CCTTAAGTCATATAGGGCAGAAT 0: 1
1: 0
2: 0
3: 9
4: 89
Right 979205958 4:118038273-118038295 GAATAAACAGCAAACAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979205958 Original CRISPR GAATAAACAGCAAACAGCAG TGG Intronic
No off target data available for this crispr