ID: 979205959

View in Genome Browser
Species Human (GRCh38)
Location 4:118038274-118038296
Sequence AATAAACAGCAAACAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979205956_979205959 -2 Left 979205956 4:118038253-118038275 CCCTTAAGTCATATAGGGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 127
Right 979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 353
979205951_979205959 30 Left 979205951 4:118038221-118038243 CCAATCTTAGAGGGTAAAGGCAG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 353
979205954_979205959 0 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 353
979205957_979205959 -3 Left 979205957 4:118038254-118038276 CCTTAAGTCATATAGGGCAGAAT 0: 1
1: 0
2: 0
3: 9
4: 89
Right 979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 353
979205955_979205959 -1 Left 979205955 4:118038252-118038274 CCCCTTAAGTCATATAGGGCAGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG 0: 1
1: 0
2: 2
3: 23
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979205959 Original CRISPR AATAAACAGCAAACAGCAGT GGG Intronic
900081713 1:863485-863507 GTTATACAGCAAACAGCTGTGGG + Intergenic
901258433 1:7852968-7852990 TATGAAAAGCAAACAGCAGGAGG + Intronic
901359502 1:8684764-8684786 AATAAACAGGAAACACTAATTGG + Intronic
901375744 1:8837537-8837559 TAAAAACAGAATACAGCAGTAGG - Intergenic
901559788 1:10061050-10061072 AAAAAACAGAAAACAGAAGGTGG - Intronic
902762737 1:18594281-18594303 CTTAAACACCAAACAGCAGAAGG - Intergenic
902852429 1:19170660-19170682 AATAAATAGTAAACGCCAGTAGG + Intronic
903022556 1:20404386-20404408 AATAAACAGCCAGGAGCAGCAGG + Intergenic
903296206 1:22344693-22344715 AATAAGAAGCAAAAAGAAGTGGG + Intergenic
903536981 1:24073473-24073495 GATAAATTGCAAGCAGCAGTTGG - Intronic
906649387 1:47501905-47501927 AATAAATAATAAATAGCAGTCGG - Intergenic
906877129 1:49551818-49551840 TATAGAGAGGAAACAGCAGTGGG + Intronic
907338151 1:53714082-53714104 AAGAAACCGGAAACAGCAATGGG + Intronic
908375574 1:63536263-63536285 AATAGATAGCAAGCAACAGTGGG - Intronic
908810038 1:67972202-67972224 AACAAAAAGCAAAAAGCAGGGGG - Intergenic
910163740 1:84300626-84300648 AATAAACATCAATCAACATTTGG - Intronic
913433758 1:118825821-118825843 AATAAACACTAAACAACTGTTGG - Intergenic
913438752 1:118875066-118875088 AATAAAGAAGAATCAGCAGTAGG - Intergenic
913594893 1:120365840-120365862 AAGCAACAGCTAACAGAAGTGGG + Intergenic
914092375 1:144513146-144513168 AAGCAACAGCTAACAGAAGTGGG - Intergenic
914306157 1:146420725-146420747 AAGCAACAGCTAACAGAAGTGGG + Intergenic
914595895 1:149152084-149152106 AAGCAACAGCTAACAGAAGTGGG - Intergenic
914800126 1:150955329-150955351 AATAAAATCCAAACAGCAGAGGG - Intronic
916117218 1:161496411-161496433 AGCAAACAGCAAACAGCAACTGG + Intergenic
919953303 1:202386775-202386797 TATAAAAATCAAACAACAGTAGG - Intronic
920962446 1:210675602-210675624 AATAAACAGGAGGCAGCACTAGG - Exonic
921119917 1:212127352-212127374 CAAAAACAGCAAACAGCATATGG + Intergenic
921887481 1:220321379-220321401 AATAAACAGGAAAAAGCAAAGGG - Intergenic
921961240 1:221036683-221036705 AATAAAAATAAAAGAGCAGTTGG - Intergenic
923085842 1:230703203-230703225 CATACACAGCAAACAGGAATGGG + Exonic
923658701 1:235940344-235940366 ATTAGACAGCAAAGAGCTGTGGG + Intergenic
923896507 1:238276095-238276117 ATTCTACAGCTAACAGCAGTTGG - Intergenic
924268287 1:242305249-242305271 AACACACAGCAATCAGGAGTGGG - Intronic
924766889 1:247041290-247041312 ATTAAAAGGCAAAAAGCAGTGGG + Intronic
924878845 1:248136410-248136432 AATAAAAAGCAAAAACTAGTAGG - Intergenic
1063085291 10:2812285-2812307 AATAAAGAACTAACAGCATTTGG + Intergenic
1065160735 10:22918667-22918689 TATAAAATGCAAACAACAGTGGG - Intergenic
1066187755 10:33026941-33026963 ATTAAACAGCAAAAAGCAACAGG + Intergenic
1066673868 10:37867381-37867403 AAAAAACTGCAAACATCACTGGG - Intergenic
1067012973 10:42731775-42731797 CAGAAACAGCAGACAGCAGAGGG - Intergenic
1067310872 10:45112343-45112365 CAGAAACAGCAGACAGCAGGGGG + Intergenic
1068084196 10:52354336-52354358 AATAAACAGAAAAGAGAATTTGG + Intergenic
1068511870 10:57976845-57976867 AAAAAACAGAAAACAACATTGGG + Intergenic
1069042200 10:63707387-63707409 AATCAACAGCAAATTGGAGTAGG - Intergenic
1070904311 10:80058402-80058424 AAAAAACAGGAAAAAGCAGGAGG + Intergenic
1071794041 10:88986406-88986428 ACTAAAAAGCAGACAGCAATTGG - Intronic
1072459195 10:95604042-95604064 CATATACAGCAAATAGCAGAGGG + Intergenic
1072549501 10:96466608-96466630 AGAAAACAACAGACAGCAGTGGG - Intronic
1072695210 10:97598435-97598457 AACAAACAGCAAACTGCAGAAGG + Intronic
1074520615 10:114219225-114219247 CATAGACAGCAAGCAGCAGTTGG - Intronic
1074913103 10:117929619-117929641 CTCAAACAGCAAACAGCAGGGGG + Intergenic
1075652029 10:124133603-124133625 AATAAGCAGCACATGGCAGTTGG + Intergenic
1075767258 10:124903451-124903473 AATAAATAGCATACTCCAGTGGG - Intergenic
1076862620 10:133146867-133146889 AATAAGCAGCTAACAGCACAGGG + Intergenic
1077221186 11:1417486-1417508 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221194 11:1417582-1417604 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221199 11:1417629-1417651 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221203 11:1417677-1417699 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221207 11:1417725-1417747 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221211 11:1417773-1417795 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221231 11:1417962-1417984 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221240 11:1418056-1418078 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221244 11:1418104-1418126 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221248 11:1418152-1418174 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221273 11:1418390-1418412 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221277 11:1418438-1418460 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221287 11:1418533-1418555 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221292 11:1418580-1418602 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077221296 11:1418628-1418650 AAGAAACAGCCAACAGAAGCAGG - Intronic
1077290820 11:1791331-1791353 ATTAAACAGCAATAAGCAATTGG - Intergenic
1077512191 11:2973491-2973513 AACAGACAGCACAGAGCAGTAGG + Intronic
1077653812 11:3999338-3999360 AACAAACAGCAAACTGGATTTGG + Intronic
1078219425 11:9339240-9339262 AATTAAAAACAAACAGCAGCCGG + Intergenic
1078273483 11:9819549-9819571 AATGGACAGCACACAGCAGAAGG + Intronic
1078892604 11:15570809-15570831 AAGAGACAGCAATCAGCAGAGGG - Intergenic
1079572753 11:21965021-21965043 AATTAACAGAAAACATCACTAGG + Intergenic
1079697827 11:23505703-23505725 AATAAACGGAAACCAGGAGTTGG - Intergenic
1080258328 11:30318499-30318521 AAAAGACACCAAAAAGCAGTGGG - Intergenic
1080485795 11:32705119-32705141 ATTCAACGGGAAACAGCAGTGGG + Intronic
1083958026 11:65997450-65997472 AAGAAACAGCAACCATCAGAGGG - Exonic
1084746962 11:71177813-71177835 AAAAAACATCCAACAGCATTAGG + Intronic
1084768025 11:71325053-71325075 AAGAAAAAGCACACAGCAGTGGG + Intergenic
1087351495 11:97039046-97039068 AACAAACAGCTGAAAGCAGTTGG + Intergenic
1087491367 11:98831276-98831298 AAAAGACAGAAAACAGGAGTAGG - Intergenic
1087583733 11:100092272-100092294 AATTAAAAAGAAACAGCAGTGGG + Intronic
1087979054 11:104588105-104588127 GATAAAGAGGAAACAGTAGTAGG + Intergenic
1088261277 11:107946171-107946193 AACAAACAGGAAACAGCAACTGG + Intronic
1088603895 11:111510895-111510917 AATAATCATAAAACATCAGTTGG + Intronic
1089818114 11:121194912-121194934 AATAAACAGCAGACACTAGAGGG - Intergenic
1089846930 11:121466013-121466035 CATAAACAACAAACAGCATCTGG - Intronic
1090703413 11:129315911-129315933 GAAAAACAGCAAGCAGCAGCAGG - Intergenic
1090950212 11:131466202-131466224 AGAAAACAGCAAAGAGGAGTGGG + Intronic
1094767654 12:33616754-33616776 AAAATGCAGAAAACAGCAGTGGG - Intergenic
1095694096 12:45124846-45124868 AATTCACAGCACACAGCTGTAGG + Intergenic
1095877453 12:47097675-47097697 CACAAACTGCAAAGAGCAGTTGG + Intronic
1096250560 12:50029408-50029430 AACAAACAAAAAACAGCAGCCGG + Intronic
1096459088 12:51812151-51812173 TATGTACAGCAAACAGCAGTGGG - Exonic
1097995422 12:65882561-65882583 GATTAAAACCAAACAGCAGTGGG - Intronic
1098092339 12:66916922-66916944 GATAAACATCATATAGCAGTAGG + Intergenic
1098820813 12:75226346-75226368 AAAAAGAAGCAAACAGCAGGTGG + Intergenic
1098867519 12:75779950-75779972 TGTAAACAGGATACAGCAGTGGG - Intergenic
1099410929 12:82326471-82326493 TATAAATAGCAAAGAGCAGCAGG + Intronic
1099631720 12:85157080-85157102 AAAATACAGCAAAAAGCAGAGGG + Intronic
1103293836 12:119869203-119869225 TAAAAACAGCAAACAGCAGATGG + Intronic
1103647458 12:122405770-122405792 AACAAAAAGGAAACAGCAGCCGG + Intronic
1104866238 12:131956603-131956625 AGTAGACTGCATACAGCAGTAGG - Intronic
1106442210 13:29785910-29785932 AATAAAAAGGAAGCAGCAGTGGG + Intronic
1106542965 13:30706322-30706344 TACAAACTGCAAACTGCAGTAGG + Intergenic
1106684003 13:32037595-32037617 AGAGAAAAGCAAACAGCAGTAGG + Intronic
1107225681 13:38045094-38045116 AATATAGAGCCAATAGCAGTGGG - Intergenic
1107292411 13:38870384-38870406 AAGAAACTTCAAACAGCAATAGG + Intronic
1107360626 13:39614004-39614026 ATTAAACAGAAAAAAGCAATTGG - Intergenic
1107899791 13:45000804-45000826 AGTAAACCCTAAACAGCAGTTGG + Intronic
1110235148 13:73210021-73210043 AAAAAACAGAAATCAGTAGTTGG - Intergenic
1110952132 13:81508275-81508297 AATAAACAGCTAAGAGCAAAGGG - Intergenic
1111288319 13:86125869-86125891 ATTAAACAGAAGACACCAGTTGG + Intergenic
1111734461 13:92119896-92119918 AATAAAGAGGAAAAAGCACTGGG + Intronic
1112926777 13:104685645-104685667 AATAATCAGCAAAAAGAAGAGGG - Intergenic
1114889137 14:26894649-26894671 ATCAATCAGCAAACAGAAGTAGG + Intergenic
1114900377 14:27050271-27050293 AAAAAATATAAAACAGCAGTTGG - Intergenic
1115247599 14:31312223-31312245 AATAAATACCAAATAGCAGATGG + Intronic
1115794191 14:36914553-36914575 AATAAACAAAACACAGAAGTTGG - Intronic
1115958972 14:38813225-38813247 AATAACCAATAAAAAGCAGTGGG + Intergenic
1117026654 14:51627519-51627541 AATCAACACAAAACAGGAGTGGG + Intronic
1117368804 14:55056827-55056849 AATAAAAAGGATATAGCAGTTGG + Intronic
1118223990 14:63882005-63882027 AATAAACTGGAAACTGCAGCAGG - Intronic
1118384836 14:65247210-65247232 AAAAAACAGCAAAAAGTAGCTGG + Intergenic
1118765357 14:68905994-68906016 AAAAAACAGCAAACACCATATGG + Intronic
1119393586 14:74308853-74308875 AAAAAAAAACAAACAGAAGTTGG - Intronic
1120425630 14:84344027-84344049 AATAAACAGAAAACAGAAGCTGG - Intergenic
1202927986 14_KI270725v1_random:10362-10384 AATAAATATAAGACAGCAGTGGG + Intergenic
1125260620 15:37820760-37820782 AAAAAACTGCACACAGCATTTGG + Intergenic
1125542502 15:40478197-40478219 AACAACCAGAAAACAGCTGTGGG + Intergenic
1126383846 15:48074226-48074248 AAGAAGCAGCCAGCAGCAGTAGG - Intergenic
1127164533 15:56231157-56231179 AATATACAGCATAGTGCAGTGGG + Intronic
1129920888 15:79318239-79318261 TATAAACAGCCAACAACAGAAGG - Intronic
1130125157 15:81087684-81087706 AAAAAAAAGCAAAAAGAAGTAGG - Intronic
1133308700 16:4828548-4828570 AATAAACTGCAGACAGCCCTTGG - Intronic
1134099618 16:11442808-11442830 AAGAAACAGCAAACACCATCGGG + Intronic
1134628361 16:15739090-15739112 AAAAAAAAGAATACAGCAGTGGG - Intronic
1135262577 16:20993868-20993890 AATAAACAGCATAAAAGAGTGGG - Intronic
1136119726 16:28124718-28124740 TAAAAACAGCACACAGTAGTAGG - Intronic
1138795674 16:59965635-59965657 TAGAAACCGGAAACAGCAGTAGG - Intergenic
1139168846 16:64605518-64605540 AATAAACCCAAAGCAGCAGTAGG + Intergenic
1139326738 16:66158367-66158389 AATAAAAATCAAACAGAAGTGGG - Intergenic
1139407779 16:66733015-66733037 TATAAAAAGCCAATAGCAGTTGG - Intronic
1140101862 16:71924860-71924882 AATAATGAGAAAACAGCAGAGGG - Intronic
1141786466 16:86203997-86204019 AATAAAAAACAAACAGCACGTGG + Intergenic
1142491178 17:280755-280777 AATAAACAAGAAAGAGCAGTTGG + Intronic
1142706404 17:1697714-1697736 CCTCAACAGCAAACAGGAGTGGG - Intergenic
1143063241 17:4221613-4221635 AATAAAAAGAAAAAAACAGTTGG - Intronic
1144225719 17:13143382-13143404 AAGAAAAAGAAAAAAGCAGTGGG - Intergenic
1144229291 17:13184106-13184128 CATAAACAGCAAATAGCACTTGG + Intergenic
1148883326 17:50750189-50750211 AAAAAACATCAAAAAGCACTGGG - Intronic
1149622612 17:58057315-58057337 AAGAAACAGCATAGAGCAGATGG + Intergenic
1149702929 17:58670430-58670452 AAAAAACAACAAACAGCTTTGGG + Intronic
1150222371 17:63503698-63503720 AAAAAACAGAAAACAAGAGTCGG - Intronic
1153671759 18:7418664-7418686 AAAAAACAAAAAAAAGCAGTGGG - Intergenic
1153697533 18:7659595-7659617 AATGCTCAGTAAACAGCAGTTGG + Intronic
1153899090 18:9599834-9599856 CATAAAAAGCAAAGGGCAGTGGG + Intronic
1155095764 18:22554815-22554837 AATAAACAGCAAAAAGTCATTGG - Intergenic
1155598829 18:27519269-27519291 AATATACAATTAACAGCAGTGGG - Intergenic
1156102851 18:33619306-33619328 GAAAAACTGCCAACAGCAGTAGG - Intronic
1156560749 18:38122821-38122843 GTCAAACTGCAAACAGCAGTTGG + Intergenic
1158231983 18:55266790-55266812 AACAAACAGCAAACCTCAGTGGG + Intronic
1158709703 18:59826434-59826456 AAAAAAAAGCAAACAGATGTTGG - Intergenic
1159375471 18:67586823-67586845 AATAAAAAGCCAACAACATTGGG + Intergenic
1159701838 18:71638936-71638958 AAAAAATAGAAAACTGCAGTAGG - Intergenic
1159714489 18:71804697-71804719 AATAAAAAATAAACAACAGTGGG - Intergenic
1160247157 18:77168089-77168111 AAGCAACAGAAAACAACAGTGGG + Intergenic
1161853181 19:6749396-6749418 CAAAATAAGCAAACAGCAGTGGG + Intronic
1162200295 19:9015140-9015162 ACTAAACAGCAAGGTGCAGTGGG + Intergenic
1162993634 19:14319528-14319550 AATAAATAGAAAACAACAGCAGG - Intergenic
1164015862 19:21255548-21255570 AAGAAAGAACAAACAGAAGTAGG + Intronic
1164290589 19:23865492-23865514 AATAAAGAGACAGCAGCAGTAGG - Intergenic
1164905635 19:31965329-31965351 AATAAACAGCAGAAAACAGCCGG - Intergenic
1165055293 19:33172662-33172684 AATACATAGCAAACAGGAGTAGG + Intronic
1165252408 19:34550922-34550944 AATAAACAAAAAACAGTAGATGG - Intergenic
1166867539 19:45849270-45849292 AGTAAACACCAAAAAGCATTCGG + Intronic
1168328455 19:55551215-55551237 AATAAAAAAAAAACAGGAGTGGG - Intergenic
925603586 2:5635186-5635208 AAGCAACAGCTAACAGAAGTGGG + Intergenic
927328315 2:21832358-21832380 TATAAAGAGGAACCAGCAGTGGG + Intergenic
928624374 2:33124462-33124484 AATGAACATCAACCAGCTGTAGG - Intronic
928747392 2:34431938-34431960 AATAACCCACTAACAGCAGTAGG - Intergenic
929551955 2:42899750-42899772 AATAAACAGCACTCCACAGTGGG - Intergenic
929809670 2:45178994-45179016 AACAAACAGCAAACAGCACAAGG + Intergenic
930744363 2:54866220-54866242 AATACACAGTAAACAACAGATGG + Intronic
930965749 2:57323243-57323265 AATATAAACCAAACACCAGTCGG + Intergenic
931110445 2:59105054-59105076 AAACAACAGCAAACAGCATTTGG + Intergenic
931987467 2:67755643-67755665 GCTAAAAAGCAAACAGCAGCAGG - Intergenic
932856904 2:75243493-75243515 AATAACCAGCTAACAACAGATGG + Intergenic
933304999 2:80586506-80586528 AATAAACCAAAAACAGCAATAGG + Intronic
935381934 2:102461628-102461650 AAAAAACAGAACACAGCAGCTGG + Intergenic
935665777 2:105510855-105510877 AATGGACAGGAAACAGAAGTGGG - Intergenic
936524323 2:113232627-113232649 AATTAACAGCTGACAGTAGTTGG + Intronic
936594477 2:113834866-113834888 AACAAACAGCCAACTGCAGGTGG + Intergenic
938368386 2:130753934-130753956 AAGAAACAGCTCAAAGCAGTAGG + Intergenic
938831862 2:135058203-135058225 TATAAACATCAAATAGCATTTGG + Intronic
939006638 2:136796093-136796115 AAAAAAAATCAAAAAGCAGTAGG - Intronic
940030981 2:149260915-149260937 AATACACAGCTAGCAGCAGAGGG - Intergenic
940250187 2:151666411-151666433 AACAAAGGGCAAACAGAAGTTGG + Intronic
940441098 2:153717204-153717226 AACAAACAGCCAACAGAAGGGGG - Intergenic
941605140 2:167587525-167587547 AATAAACAAGAGACAGCATTTGG - Intergenic
941999950 2:171636198-171636220 AATAAAAAACAAACAACACTGGG - Intergenic
943337658 2:186637924-186637946 AATACAGAGCAAACTGAAGTGGG - Intronic
944520383 2:200560083-200560105 AATAAACAGACAACAGAAGCAGG - Intronic
944949756 2:204734752-204734774 AATTAACTGCAAAGAGCAGGAGG + Intronic
945502757 2:210597970-210597992 AATAAATAGAAACCAGCAGAAGG + Intronic
947954601 2:234177698-234177720 AAAAACCAACAAACAGCAGGAGG - Intergenic
1170434239 20:16308694-16308716 AATAAACAGCAAGCAAATGTGGG + Intronic
1170797940 20:19565944-19565966 AATAACCAACATACAGAAGTTGG - Intronic
1170966726 20:21079630-21079652 AATAAATAGAATAAAGCAGTTGG + Intergenic
1171103156 20:22405268-22405290 AAAAAACAGCAAATTTCAGTTGG - Intergenic
1176187074 20:63786475-63786497 AACAAACAAAAAACAGCAGTTGG - Intronic
1176590010 21:8639029-8639051 AATAAATATAAGACAGCAGTGGG + Intergenic
1177705473 21:24698688-24698710 AAAAATCAGCAACCAGCAATAGG + Intergenic
1177832592 21:26155671-26155693 AATCAACAGCAAATATCATTGGG + Intronic
1178008746 21:28257140-28257162 AATAAACAGGAACCAGCATATGG - Intergenic
1178797547 21:35758940-35758962 AATAAACAGGAAGCACCAGGAGG + Intronic
1178964313 21:37101414-37101436 AATAAAGAGCACACACCAGAGGG - Intronic
1179226944 21:39462381-39462403 AAGAAACAGCAAGAAGTAGTGGG + Exonic
1180255184 21:46622065-46622087 AAAGAACAGCAAATAGCAGAGGG + Intergenic
1180272844 22:10616046-10616068 AATAAATATAAGACAGCAGTGGG + Intergenic
1180399032 22:12390939-12390961 AATAACCAGCAAACATCATAAGG + Intergenic
1181283832 22:21738165-21738187 AAAAAACAGAAAATAACAGTTGG - Intergenic
1181751617 22:24992846-24992868 AATATACATCAAAAAGCACTTGG - Intronic
1182172859 22:28250740-28250762 AAATATCTGCAAACAGCAGTTGG + Intronic
1185054924 22:48574687-48574709 AATGACCAGAAAAGAGCAGTGGG - Intronic
1185353320 22:50349824-50349846 AAAAAACAGAAAAAAGCAGCTGG + Intronic
949137274 3:582678-582700 AATAAATATAAGACAGCAGTGGG - Intergenic
949211180 3:1503454-1503476 TATTAACAGCAAACAGGTGTAGG + Intergenic
952708566 3:36405879-36405901 AATAAAAACTAAAAAGCAGTCGG - Intronic
953860785 3:46542679-46542701 AACAAACAGCAAACAGCTCGGGG + Intronic
955122697 3:56076734-56076756 AATAAACAGAAAACCCCAGGTGG - Intronic
955287658 3:57658629-57658651 AATAAAAAACAGATAGCAGTAGG - Intronic
956267085 3:67408807-67408829 CTTAAACATCACACAGCAGTAGG + Intronic
956489947 3:69760270-69760292 AAAATCCAGCAAAAAGCAGTAGG + Intronic
956943515 3:74193287-74193309 AATACACATCAAACATCATTTGG + Intergenic
957181653 3:76886614-76886636 CATAAAAAGCAAATAGAAGTTGG + Intronic
958982472 3:100738428-100738450 CATAAACAGCAAACATTATTTGG - Intronic
960537522 3:118829631-118829653 AAGAAACAGAAAACACCAATTGG + Intergenic
960620353 3:119631056-119631078 AAAAAAAAGCAACGAGCAGTGGG - Intergenic
960865714 3:122197669-122197691 AATCAACAGCACAAGGCAGTTGG - Intronic
961201431 3:125048786-125048808 AAACAACAGAAAAGAGCAGTGGG + Intronic
961218907 3:125184358-125184380 AATAATCAGCAAAAAGGATTTGG - Intronic
961323792 3:126097731-126097753 GACAAACAGCAACCAGCAGCTGG + Intronic
962701325 3:138002442-138002464 ATTAAACAGAAAACAGAATTGGG - Intronic
963385142 3:144583093-144583115 AAAAAACAGAAAACAGAAGAGGG - Intergenic
964673252 3:159249953-159249975 AATAAACAGAGAAGAGCAATTGG + Intronic
965214486 3:165844277-165844299 AATAAAAAGAAAAGAGAAGTTGG + Intergenic
965504597 3:169498969-169498991 AATAAACTGCACACAGCTGAAGG + Intronic
966073017 3:175902782-175902804 AATAAATAGCAAACGGGAGGAGG + Intergenic
966238933 3:177733429-177733451 AATAAACAGAAAACCACAGATGG - Intergenic
967608777 3:191480537-191480559 AAAAAACAAAAAACAGCTGTTGG + Intergenic
968248299 3:197178294-197178316 AATAAAAAGCCAACAGGATTTGG + Intronic
969135657 4:5026671-5026693 AAGAAACAGCAACCTGCTGTTGG + Intergenic
969884192 4:10200718-10200740 AATAAACACCAACCAGCATTAGG - Intergenic
970460982 4:16274704-16274726 AACAAACAAAAAACAGCAGTGGG - Intergenic
970530406 4:16975773-16975795 AAAAAAAAGTAAACAGCATTTGG + Intergenic
971843143 4:31880780-31880802 AGTACACAGGAGACAGCAGTGGG - Intergenic
974073818 4:57150399-57150421 AATAAAAATCAGCCAGCAGTTGG - Intergenic
974252637 4:59407598-59407620 AATAAAAAGCAAACAGTGTTTGG + Intergenic
974776201 4:66485208-66485230 AATAATCATCAAATAGTAGTCGG - Intergenic
974809556 4:66928405-66928427 CATATTCAGCAAACGGCAGTAGG + Intergenic
976449431 4:85170412-85170434 AATAAACAGGAAATAACTGTTGG - Intergenic
976623748 4:87156197-87156219 GATAAAAAGCAAATAGCTGTAGG - Intergenic
979205959 4:118038274-118038296 AATAAACAGCAAACAGCAGTGGG + Intronic
979722907 4:123923356-123923378 AAAAAAAAGAAAACAACAGTAGG - Intergenic
980136463 4:128863108-128863130 CAAAAGCAGCAAACAGCAGAAGG - Intronic
980678337 4:136120487-136120509 AATAAACAGCAAACATAACAAGG + Intergenic
981064686 4:140470121-140470143 AAGAAAGAGCACACAGCAGCGGG - Intronic
982284532 4:153721359-153721381 AATGAACAGAAAACAGAAATAGG - Intronic
982704282 4:158690270-158690292 AAAAAACAGTAAACAGCCTTAGG - Intronic
983348877 4:166561625-166561647 AATAAACAGCAGGCAGAAGAAGG - Intergenic
984090605 4:175369689-175369711 AATTTAAACCAAACAGCAGTAGG - Intergenic
984167689 4:176321442-176321464 AGTAAACAGTAAATAGCAGCTGG + Intronic
984647647 4:182236789-182236811 AATACACAGCAAATCTCAGTGGG - Intronic
985220846 4:187702957-187702979 GATAAAGAACAAACAGCAGTTGG - Intergenic
985859008 5:2455539-2455561 AACAAACAAAAAACAGCAGAGGG - Intergenic
986834233 5:11616900-11616922 AAGAAACAGCAAACAGGGCTGGG - Intronic
987278101 5:16383786-16383808 CACAAACAGCAAACAGATGTAGG - Intergenic
987670775 5:21004772-21004794 AATAAACTGTAAACAGCAGAAGG + Intergenic
987869306 5:23592536-23592558 GATATACAGCAAAGAGCTGTGGG - Intergenic
988001507 5:25355458-25355480 CATAAACAGCAAATAGGATTGGG - Intergenic
988135969 5:27172298-27172320 AATAAAAAACAAACATCACTGGG + Intergenic
991687710 5:69196936-69196958 AATATACATAAAACAGAAGTAGG - Intronic
992410137 5:76497257-76497279 AATAAACTCCAAACCGCAGAAGG - Intronic
993145833 5:84092813-84092835 AACAAACAAAAAACAGAAGTGGG + Intronic
994784818 5:104144577-104144599 AATAAAAAGCAAGCACCAGGTGG + Intergenic
996886362 5:128359464-128359486 AATAAAATGCAAATAACAGTGGG + Intronic
997521963 5:134528650-134528672 AAACAACAGCCAACAGCACTTGG - Intronic
998718971 5:144920780-144920802 AAGAAACAACAAACAGCAAATGG - Intergenic
999476498 5:151904319-151904341 AACAAGCAGCAGAAAGCAGTGGG - Intronic
999932016 5:156443818-156443840 GAGAAAGAGCACACAGCAGTGGG + Intronic
1000219927 5:159204820-159204842 AAAAAAAAGCAAACAAAAGTGGG + Intronic
1004267689 6:14163429-14163451 ACTAAACAGTAAAAAGGAGTAGG + Intergenic
1006895154 6:37463472-37463494 AAGATACAGAAAACAGCATTTGG - Intronic
1007997158 6:46320556-46320578 AATAAAATGCACAGAGCAGTAGG + Intronic
1009741450 6:67752398-67752420 AATAGAAACGAAACAGCAGTCGG - Intergenic
1011758563 6:90532269-90532291 AATAAAAAGAAAATAGCACTTGG - Intronic
1014656921 6:124118295-124118317 AATAAAAAGGAAACAACACTAGG + Intronic
1016754964 6:147674834-147674856 AATAAAGGGGAAACAGCAGAAGG - Intronic
1016980023 6:149845465-149845487 AATAAACAACAAAAGGCAGGTGG - Intronic
1019072805 6:169363239-169363261 TATAAAAAGAAAACAGTAGTTGG + Intergenic
1019843778 7:3476285-3476307 TATAAACAGCAAACAGCTGTGGG - Intronic
1020507183 7:9006083-9006105 AATAAAATGCAGACAGCAGATGG + Intergenic
1021156073 7:17211579-17211601 AACAAACAAAAAACAGCAGTAGG - Intergenic
1021261520 7:18463851-18463873 AATAAACAGATAACATCTGTGGG - Intronic
1021872987 7:25021872-25021894 CATACCCAGAAAACAGCAGTTGG + Intergenic
1022425197 7:30261999-30262021 AATACAGAGGAAACTGCAGTGGG + Intergenic
1024008238 7:45243007-45243029 AAAAAAAAGCAAACAGCTGGAGG - Intergenic
1026384364 7:69831408-69831430 AATAAGCAACAAAAAACAGTTGG + Intronic
1027059279 7:75073090-75073112 TATAAACAGCTAGCAGCGGTGGG + Intronic
1028620682 7:92824514-92824536 AATAAACAGGAAAGACCACTGGG + Intronic
1028802918 7:94988124-94988146 AATAAAGACCAAACATCAGCAGG - Intronic
1029682795 7:102123652-102123674 AATAAATAAAAAAAAGCAGTAGG - Intronic
1031452802 7:121942868-121942890 ATTAAACAGCTAGCAGCTGTTGG + Intronic
1032889708 7:136181439-136181461 AAGAAAAAGCAAACTGCAGAAGG - Intergenic
1033227128 7:139571180-139571202 ATTCAACAGCAAACAGAGGTTGG + Exonic
1033280631 7:140004024-140004046 AATGAGCAGAAAACAGCAGTTGG - Intronic
1034112857 7:148555273-148555295 AAGAAAAAGAAAACAGCAGATGG + Intergenic
1034202918 7:149293710-149293732 AATAAACAGGAAACAGGATCAGG - Intronic
1034311684 7:150094443-150094465 GATAAACAGTAACCAACAGTGGG - Intergenic
1034795167 7:154006211-154006233 GATAAACAGTAACCAACAGTGGG + Intronic
1035523555 8:294065-294087 GTTATACAGCAAACAGCTGTGGG - Intergenic
1035844602 8:2849308-2849330 ATTAAACAACCAACAGTAGTAGG - Intergenic
1036725396 8:11216299-11216321 TAAAAACAGCAGAGAGCAGTAGG - Intergenic
1037193330 8:16154736-16154758 AATAGACAGCAAACAGTATAAGG - Intronic
1037602569 8:20410096-20410118 AATGCACAGCAAACTCCAGTGGG + Intergenic
1038722146 8:30046745-30046767 AATAATAAGGAAACAGCAGAGGG - Intergenic
1039922040 8:41900013-41900035 AAGGAACAGCAGACAGCACTTGG + Intergenic
1040395813 8:46999181-46999203 AAGAAATAGCAGACACCAGTAGG - Intergenic
1042678993 8:71358739-71358761 AATCAACAGCAATCAGAAATAGG - Intronic
1042775273 8:72423869-72423891 AATAATTAGCAAACAGCACTGGG - Intergenic
1043501522 8:80862454-80862476 AATAAAGAGCAAAAAGGACTTGG + Intronic
1043685890 8:83085724-83085746 AATAACCAGCAAACAGGAAGAGG - Intergenic
1044071107 8:87760959-87760981 AATAAACAACAAACAGTTGTTGG + Intergenic
1045498913 8:102730131-102730153 AATATACAGCAGAGATCAGTCGG - Intergenic
1045530004 8:102975617-102975639 AACAAACAGCATACAACTGTAGG + Intronic
1047192190 8:122688171-122688193 AATAAAAAGCAAATATCTGTTGG + Intergenic
1047778394 8:128092175-128092197 AATAAATGGGAAACAGCAGGGGG - Intergenic
1048383092 8:133885459-133885481 AATAAACTGCAGACTCCAGTTGG + Intergenic
1048739762 8:137542108-137542130 AATCAACATAAAACATCAGTTGG - Intergenic
1049075626 8:140394027-140394049 AAGAAAGAGCAAACAGCAAAAGG + Intronic
1050024936 9:1323675-1323697 AATCCAAAGCAGACAGCAGTTGG - Intergenic
1050714138 9:8501607-8501629 AATAAACAACAAACATAAGAGGG + Intronic
1050801919 9:9625998-9626020 AAAAAACAGCAATCAACAATAGG + Intronic
1051926336 9:22331584-22331606 AATGAACAGCAAGAAGCAGGAGG - Intergenic
1055938936 9:81630679-81630701 AAACAGCAGCAAACAGCAATTGG + Intronic
1055966827 9:81873508-81873530 AATAAATAACAATAAGCAGTGGG - Intergenic
1056390748 9:86139403-86139425 AATAAACAGCAAAAAGGGGCTGG + Intergenic
1056673214 9:88649367-88649389 AATAGAAAGCAAATAGCAGGAGG - Intergenic
1056809389 9:89752502-89752524 CAAAAACATCAAAGAGCAGTGGG - Intergenic
1056946607 9:91003061-91003083 AATAAATAGAAAGCAGCAGGAGG - Intergenic
1058883987 9:109309112-109309134 AATAATCAGGAAAGGGCAGTAGG + Intronic
1059982734 9:119790974-119790996 ATCAAAAAGCTAACAGCAGTGGG + Intergenic
1060069908 9:120537163-120537185 GATAAACATCAAACAGAATTGGG + Intronic
1060238689 9:121884980-121885002 AGAAAACAGAAAACAGAAGTGGG - Intronic
1060315523 9:122506676-122506698 AAGAAACAGAAGGCAGCAGTTGG + Intergenic
1060764832 9:126287056-126287078 ATTAAACAGAAAACTTCAGTTGG - Intergenic
1060777623 9:126387486-126387508 AGAAAACAGCAAAAAACAGTGGG - Intronic
1203584476 Un_KI270746v1:51783-51805 TATAAACAACAAAAACCAGTAGG + Intergenic
1203620025 Un_KI270749v1:117676-117698 AATAAATATAAGACAGCAGTGGG + Intergenic
1185987635 X:4853509-4853531 TATTAACAGAAAACAGCAGCAGG - Intergenic
1185992542 X:4907814-4907836 AATAAACATCAACTAGCAGCTGG - Intergenic
1186306333 X:8263252-8263274 ATAAAACAGAAAACAGTAGTAGG - Intergenic
1188854638 X:35178038-35178060 AGTAAAAAGAAAACAGCACTTGG - Intergenic
1190241680 X:48661511-48661533 AGTAAACAGCAAACATAAGATGG - Intergenic
1191654294 X:63579073-63579095 AATAAACAGCTAACAACACAAGG + Intergenic
1193766730 X:85538334-85538356 AATAGACAACAAACCGCAATAGG - Intergenic
1193884000 X:86962577-86962599 ATTAAATAGGAAACAGCATTTGG - Intergenic
1194100584 X:89698765-89698787 AAAAAAAATGAAACAGCAGTTGG - Intergenic
1194933222 X:99914985-99915007 CATGAACAGAAAACAGCAGCTGG - Intergenic
1196035341 X:111137752-111137774 CACAAACTGCAAACAGCATTTGG - Intronic
1197143341 X:123141423-123141445 CAGAAACAGCATAAAGCAGTGGG + Intergenic
1200366375 X:155669696-155669718 AATAAACAGCAAAAAGCACTTGG + Intronic
1200453539 Y:3359824-3359846 AAAAAAAATGAAACAGCAGTTGG - Intergenic
1201268298 Y:12230136-12230158 TATCAAAAGCAATCAGCAGTGGG + Intergenic
1202581358 Y:26384488-26384510 TATAAAAATCAAACAACAGTAGG + Intergenic