ID: 979205960

View in Genome Browser
Species Human (GRCh38)
Location 4:118038275-118038297
Sequence ATAAACAGCAAACAGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 360}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979205956_979205960 -1 Left 979205956 4:118038253-118038275 CCCTTAAGTCATATAGGGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 127
Right 979205960 4:118038275-118038297 ATAAACAGCAAACAGCAGTGGGG 0: 1
1: 0
2: 3
3: 39
4: 360
979205954_979205960 1 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205960 4:118038275-118038297 ATAAACAGCAAACAGCAGTGGGG 0: 1
1: 0
2: 3
3: 39
4: 360
979205955_979205960 0 Left 979205955 4:118038252-118038274 CCCCTTAAGTCATATAGGGCAGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 979205960 4:118038275-118038297 ATAAACAGCAAACAGCAGTGGGG 0: 1
1: 0
2: 3
3: 39
4: 360
979205957_979205960 -2 Left 979205957 4:118038254-118038276 CCTTAAGTCATATAGGGCAGAAT 0: 1
1: 0
2: 0
3: 9
4: 89
Right 979205960 4:118038275-118038297 ATAAACAGCAAACAGCAGTGGGG 0: 1
1: 0
2: 3
3: 39
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979205960 Original CRISPR ATAAACAGCAAACAGCAGTG GGG Intronic
900733244 1:4276891-4276913 ATGTACAGAAAACAGAAGTGAGG - Intergenic
900753683 1:4418058-4418080 ATAAACTGCATACAGCAGAATGG - Intergenic
901375743 1:8837536-8837558 AAAAACAGAATACAGCAGTAGGG - Intergenic
901480169 1:9519689-9519711 ATGAACAGCTAACAGGATTGTGG - Intergenic
904906166 1:33898922-33898944 ACAGACAGCAAACAGAAGTCAGG + Intronic
905287052 1:36888322-36888344 AAAAACAGCAAAACCCAGTGTGG + Intronic
905392616 1:37647377-37647399 ATAAAAAGCAAACAACAGGTTGG - Intergenic
907338152 1:53714083-53714105 AGAAACCGGAAACAGCAATGGGG + Intronic
907508788 1:54943196-54943218 CTAGACTGCACACAGCAGTGGGG - Intergenic
907751957 1:57271342-57271364 AAATACAGTAAACACCAGTGAGG - Intronic
908716194 1:67072353-67072375 ATATATAGAAATCAGCAGTGAGG + Intergenic
910715509 1:90225442-90225464 CTAAGCTGCACACAGCAGTGGGG - Intergenic
911094090 1:94041797-94041819 ATTAACAGAAAACAGCAGGCCGG + Intronic
911569329 1:99504148-99504170 ATACCAAGGAAACAGCAGTGAGG + Intergenic
912129512 1:106584487-106584509 ATAAAGAGCAAAAAGCAGATTGG - Intergenic
912223235 1:107701410-107701432 TTAAGCTGCACACAGCAGTGGGG + Intronic
912978882 1:114352962-114352984 AGCAGCAGCGAACAGCAGTGTGG + Intergenic
913594894 1:120365841-120365863 AGCAACAGCTAACAGAAGTGGGG + Intergenic
914092374 1:144513145-144513167 AGCAACAGCTAACAGAAGTGGGG - Intergenic
914306158 1:146420726-146420748 AGCAACAGCTAACAGAAGTGGGG + Intergenic
914595894 1:149152083-149152105 AGCAACAGCTAACAGAAGTGGGG - Intergenic
914836397 1:151210342-151210364 AAAAAAAAAAAACAGCAGTGTGG - Intronic
915682831 1:157598118-157598140 GAAAACACCAAACAGCAATGTGG + Intergenic
916329474 1:163598438-163598460 ATAAAAAGCAAGTAGCTGTGTGG + Intergenic
916624952 1:166545505-166545527 ATCAACAACAAACAGAAATGTGG + Intergenic
917466914 1:175287639-175287661 ATGGACAGAAAACAGAAGTGAGG - Intergenic
918205023 1:182300485-182300507 AGAAACTGGAAACAGCAGGGAGG + Intergenic
918376145 1:183911203-183911225 ATAAATAGCAAATTGGAGTGAGG + Intronic
918480303 1:184970900-184970922 ATAAACAGGAAAACACAGTGTGG + Intronic
919336109 1:196236816-196236838 ATAAAAGGCAAACAGCTTTGTGG + Intronic
919629531 1:199946601-199946623 ACATACAGAAAACAGAAGTGAGG - Intergenic
919957522 1:202433793-202433815 ATAAACAGAGAACAGTCGTGGGG - Intronic
921119918 1:212127353-212127375 AAAAACAGCAAACAGCATATGGG + Intergenic
921203928 1:212831946-212831968 GGAAACAGAAAACAGCAGGGTGG - Intronic
921864646 1:220075413-220075435 ATATACAGCAAATCTCAGTGAGG - Intronic
921887480 1:220321378-220321400 ATAAACAGGAAAAAGCAAAGGGG - Intergenic
922857331 1:228786134-228786156 ATGTACAGAAAACAGAAGTGAGG + Intergenic
923052931 1:230401465-230401487 GTAAATAGCAAACAGCACTAAGG + Intronic
923261695 1:232273887-232273909 ATTAACATCAAACACCAGGGAGG + Intergenic
924042255 1:239995419-239995441 ATATACAGCAAGCAGTTGTGAGG + Intergenic
924219839 1:241862661-241862683 GTAAATATCATACAGCAGTGAGG - Intronic
1063334135 10:5194319-5194341 AAAAACAACAAATATCAGTGTGG + Intergenic
1063816773 10:9784303-9784325 ATATACAGAAAACAGAAGTGAGG + Intergenic
1064043813 10:11992850-11992872 ATAAAAAGAAAGCAGCAGTCAGG + Intronic
1064137302 10:12762126-12762148 AGAAACAGTAGAAAGCAGTGCGG + Intronic
1064577081 10:16757378-16757400 AGAAACAGCTGACAGCAGAGGGG + Intronic
1065899223 10:30190132-30190154 ATATACCGAAATCAGCAGTGAGG + Intergenic
1066266040 10:33776360-33776382 AAAAAAAGCAAACACCAATGAGG - Intergenic
1067990459 10:51205939-51205961 ATAAACAGCAAATAGGAGACTGG + Intronic
1068472786 10:57486379-57486401 ATGAACAGCAACCAACACTGAGG - Intergenic
1069092000 10:64210919-64210941 AGAGACAGCTAAAAGCAGTGAGG + Intergenic
1070109593 10:73471812-73471834 ATAGACAGTAAACAGCAAAGTGG + Intronic
1070306760 10:75244385-75244407 ACAAACAAAAAACACCAGTGAGG + Intergenic
1070828457 10:79404549-79404571 GCAATCAGCAAACAGCAGGGTGG - Intronic
1071084830 10:81857532-81857554 AATAACAGCATAAAGCAGTGGGG - Intergenic
1071436407 10:85651805-85651827 ATAGGCAGCAAACAGAAGTGAGG - Intronic
1072444416 10:95486086-95486108 ACACACTCCAAACAGCAGTGTGG + Intronic
1072459196 10:95604043-95604065 ATATACAGCAAATAGCAGAGGGG + Intergenic
1073227504 10:101935646-101935668 TTAGACAGCAAACAGCTGTGAGG - Intronic
1073267531 10:102236874-102236896 ATAAACATGAAACTGAAGTGAGG + Intronic
1074550044 10:114434178-114434200 CTAAACTGCAAACTGCAGTGTGG + Intronic
1075106989 10:119546069-119546091 CCAAACAGCAACCAGCTGTGTGG + Intergenic
1076099421 10:127763641-127763663 GTATACAGAAAACAGAAGTGAGG + Intergenic
1076977767 11:188140-188162 ACATACAGAAAACAGAAGTGAGG - Intronic
1077438265 11:2555360-2555382 GTTAACAGCCATCAGCAGTGGGG + Intronic
1078965581 11:16336789-16336811 AGAAACAGAAAACAACAGAGTGG - Intronic
1079149017 11:17881408-17881430 ACAGACAGCAAGAAGCAGTGGGG - Intronic
1079767506 11:24413744-24413766 ATAAAGAGAAAACAGCTTTGGGG + Intergenic
1080485796 11:32705120-32705142 TTCAACGGGAAACAGCAGTGGGG + Intronic
1084768026 11:71325054-71325076 AGAAAAAGCACACAGCAGTGGGG + Intergenic
1086150693 11:83607097-83607119 ACATACAGAAAACAGAAGTGAGG + Intronic
1086474060 11:87151462-87151484 ATAAACAGAAAAAAGAAATGTGG - Intronic
1086587083 11:88464928-88464950 AACAACAACAAAAAGCAGTGTGG + Intergenic
1086760804 11:90628143-90628165 CTAAAGAGAAAACAGCAGTGTGG + Intergenic
1086836505 11:91631015-91631037 ATGTACAGCCAACAGAAGTGAGG - Intergenic
1086919633 11:92571537-92571559 AAAAACTGCAAAGAGAAGTGAGG - Intronic
1087583734 11:100092273-100092295 ATTAAAAAGAAACAGCAGTGGGG + Intronic
1089409353 11:118226458-118226480 ATGTACAGGAAACAGAAGTGAGG - Intergenic
1090059306 11:123450177-123450199 ATAGTCTGCAAACAGCAGTTAGG + Intergenic
1090448022 11:126780813-126780835 AAAAACACCACACAGCAGGGAGG + Intronic
1090705570 11:129333281-129333303 ACAAACAACAAACAGTAATGTGG + Intergenic
1091054517 11:132405823-132405845 ATAAACAATAAACAGCACTCAGG - Intergenic
1091561507 12:1617745-1617767 AAAGACAGCAGAGAGCAGTGGGG + Intronic
1091789301 12:3262550-3262572 ATAAAGGGCAAACGGCAGGGTGG - Intronic
1092769488 12:11883916-11883938 AAACACAGCAAAAAGGAGTGAGG - Intronic
1092801043 12:12167254-12167276 ATGATCAGCAAACAGTATTGTGG + Intronic
1093062350 12:14620371-14620393 ATAGACAGAAAACAGAAGTGAGG - Intronic
1096003483 12:48149154-48149176 ATAAACAGAAAACAAAAGTGAGG + Exonic
1096459087 12:51812150-51812172 ATGTACAGCAAACAGCAGTGGGG - Exonic
1096851419 12:54440483-54440505 ATAGACAGAAAACAGCAGGTAGG + Intergenic
1097634245 12:62103187-62103209 ATGAACAGCAAACAGGATTTTGG - Intronic
1097748019 12:63320525-63320547 ATATACAGAAAACAAAAGTGAGG - Intergenic
1097995421 12:65882560-65882582 ATTAAAACCAAACAGCAGTGGGG - Intronic
1098400368 12:70068856-70068878 ACATACAGAAAACAGAAGTGAGG + Intergenic
1098797961 12:74916854-74916876 AGAAACAGCAAAGAGCTGTTTGG - Intergenic
1099011300 12:77294558-77294580 ATAAAGAACAAACTTCAGTGTGG - Intergenic
1101510365 12:105387667-105387689 ATACCCAGCCACCAGCAGTGTGG + Intronic
1102432001 12:112890903-112890925 ATGTACAGCACACAGCAGGGAGG + Exonic
1103514302 12:121497084-121497106 GGAAACAGCAAACAGCACAGTGG + Intronic
1103953750 12:124565879-124565901 AGAAATGGCAAGCAGCAGTGAGG - Intronic
1104449491 12:128857603-128857625 CTAATCAGCAATGAGCAGTGAGG + Intronic
1107949534 13:45449399-45449421 ATAAAATGCAAACACCACTGTGG + Intergenic
1108018567 13:46101217-46101239 ATAAACAGCAAATGGAAATGAGG - Intronic
1108271715 13:48767746-48767768 ATGTACAGAAATCAGCAGTGAGG + Intergenic
1108277341 13:48824647-48824669 ATGGACAGAAAACAGAAGTGAGG - Intergenic
1108736263 13:53286235-53286257 ATCGGCAGCAAATAGCAGTGTGG + Intergenic
1109034690 13:57241482-57241504 GTTATCAGCAAACAACAGTGTGG - Intergenic
1109647434 13:65276511-65276533 ACATACAGAAAACAGAAGTGAGG - Intergenic
1109665444 13:65529110-65529132 ATGAACAGAAAACTGAAGTGAGG - Intergenic
1110273494 13:73617114-73617136 ATAATCAGCAGGCAGCGGTGAGG - Intergenic
1110982310 13:81916564-81916586 ACATACAGAAAACAGAAGTGAGG - Intergenic
1111684280 13:91482714-91482736 CTAAACAGCAAGAAGCAGCGTGG - Intronic
1112089597 13:96068815-96068837 ATAAACTGGAACCAGGAGTGGGG + Intergenic
1112579062 13:100662982-100663004 ATGGACAGCAAACAGCAGCGCGG + Exonic
1113284901 13:108836128-108836150 CTCAGCAGCACACAGCAGTGAGG - Intronic
1113836805 13:113333323-113333345 GAAAACAGCACAGAGCAGTGTGG + Intronic
1113975299 13:114223716-114223738 ATAAATAGCAAAGAGTAGTTAGG - Intergenic
1114727094 14:24949917-24949939 ATGTACAGAAAACAGAAGTGAGG - Intronic
1115537943 14:34391186-34391208 ACAAAAATCAAACAACAGTGGGG + Intronic
1117625596 14:57634545-57634567 AAAAACAGAAAACTCCAGTGTGG + Intronic
1117694674 14:58348058-58348080 ATAAACAGAAAACAGAAGGAAGG - Intronic
1118362525 14:65068434-65068456 CAAAACAACAAACAGAAGTGGGG + Intronic
1118418400 14:65570993-65571015 ATATACAGAAATCAGAAGTGAGG - Intronic
1119228375 14:72961313-72961335 ATGAGCAGGACACAGCAGTGAGG - Intergenic
1119712232 14:76830469-76830491 AAAACCAGCTAACAGAAGTGGGG - Intronic
1120154253 14:81075206-81075228 ATATACAGAAAACAGAAGTGAGG - Intronic
1120274784 14:82358812-82358834 ATATACAGCACACATGAGTGTGG + Intergenic
1121041053 14:90748157-90748179 ATAAAAAACAAACAGCAAAGTGG - Intronic
1124031806 15:26018778-26018800 ACAAACAGAAATCAGCAGTGAGG + Intergenic
1124601553 15:31136700-31136722 ACAAACAGCAAAAAGCAGATTGG - Intronic
1127164534 15:56231158-56231180 ATATACAGCATAGTGCAGTGGGG + Intronic
1127914140 15:63441671-63441693 ATGAACAGGACACAACAGTGGGG + Intergenic
1128204131 15:65835685-65835707 ACAAACAGAAAAAAGAAGTGAGG + Intronic
1128336179 15:66787109-66787131 AGAAAGAGTAGACAGCAGTGTGG - Intergenic
1128896679 15:71379966-71379988 AGATACAGAAAACAGAAGTGAGG + Intronic
1129920887 15:79318238-79318260 ATAAACAGCCAACAACAGAAGGG - Intronic
1132794651 16:1713647-1713669 AGCAACAGGAAACAGCAGAGAGG + Intronic
1133498912 16:6346536-6346558 ATGGACAGAAAACAGAAGTGAGG - Intronic
1133539053 16:6730949-6730971 ATGATCAAGAAACAGCAGTGAGG + Intronic
1134476977 16:14582544-14582566 ATAAATAGCACCCACCAGTGTGG - Intronic
1134628360 16:15739089-15739111 AAAAAAAGAATACAGCAGTGGGG - Intronic
1135193368 16:20373755-20373777 ATGTACAGAAAACAGAAGTGAGG - Intronic
1137071909 16:35911004-35911026 ATAAACAACACAAGGCAGTGTGG + Intergenic
1138795673 16:59965634-59965656 AGAAACCGGAAACAGCAGTAGGG - Intergenic
1139220652 16:65178248-65178270 ATAAAAATCAAACAGAACTGAGG + Intergenic
1139618978 16:68121516-68121538 ATAAAAAGTAACCAGGAGTGTGG + Intronic
1140024755 16:71276097-71276119 ATATACAGAAAACAGAAGTGAGG - Intergenic
1141155129 16:81592117-81592139 ATAAACAGTAAACTGCAGCCAGG - Intronic
1141502637 16:84454485-84454507 ATAAACAGTAATCAACAGTGCGG - Intronic
1142442562 16:90109188-90109210 ACATACAGAAAACAGAAGTGAGG + Intergenic
1142465187 17:132605-132627 ACATACAGAAAACAGAAGTGAGG - Intergenic
1142491179 17:280756-280778 ATAAACAAGAAAGAGCAGTTGGG + Intronic
1142706403 17:1697713-1697735 CTCAACAGCAAACAGGAGTGGGG - Intergenic
1142871008 17:2820689-2820711 ATGAAAATCAAACATCAGTGAGG - Intronic
1143038991 17:4018560-4018582 ACACACAGAAAACAGAAGTGAGG + Intronic
1143086167 17:4417643-4417665 AAAAACACAAGACAGCAGTGTGG - Intergenic
1146741323 17:35286254-35286276 ATAGACAGAAAACAGAAGTGAGG + Intergenic
1148201314 17:45751866-45751888 ATAAACAGCAAAAAACAGGGAGG - Intergenic
1149138656 17:53402355-53402377 ATAAACAACAAACAGCATTTTGG + Intergenic
1153088601 18:1318300-1318322 ATAATCAGCAAATGGTAGTGAGG + Intergenic
1153671758 18:7418663-7418685 AAAAACAAAAAAAAGCAGTGGGG - Intergenic
1153891012 18:9515128-9515150 ACACACAGAAAACAGAAGTGAGG + Intronic
1154084084 18:11285110-11285132 ATAAACAGAAAGCAGCAATGTGG + Intergenic
1154436794 18:14350112-14350134 AAAAATAGCCTACAGCAGTGTGG + Intergenic
1155598828 18:27519268-27519290 ATATACAATTAACAGCAGTGGGG - Intergenic
1156102850 18:33619305-33619327 AAAAACTGCCAACAGCAGTAGGG - Intronic
1156170717 18:34481893-34481915 AGAAATAGCAAACATCATTGTGG + Intergenic
1156378614 18:36536712-36536734 AAAAAAAGCAGACAGGAGTGTGG - Intronic
1157005638 18:43580468-43580490 AAAAACAGCAAAGTGTAGTGAGG - Intergenic
1157929640 18:51807509-51807531 ATATACAGGAAACAGAAGTGAGG - Intergenic
1157938261 18:51896762-51896784 ATACAATGCAAAGAGCAGTGAGG - Intergenic
1161853182 19:6749397-6749419 AAAATAAGCAAACAGCAGTGGGG + Intronic
1162200296 19:9015141-9015163 CTAAACAGCAAGGTGCAGTGGGG + Intergenic
1163180100 19:15593265-15593287 AGAAGCAGCAAACAGCTATGAGG + Intergenic
1163395772 19:17060078-17060100 CTTAACAGCAGATAGCAGTGGGG - Exonic
1163520587 19:17789266-17789288 AGTAACAGCAGACTGCAGTGGGG + Intergenic
1163899051 19:20084562-20084584 AAAAACTGTAAAAAGCAGTGTGG - Intronic
1163957376 19:20656863-20656885 AACAACAGTAAAAAGCAGTGTGG + Intronic
1165910852 19:39226081-39226103 ATAAAAAGCCTACAGCTGTGGGG + Intergenic
1167732385 19:51268013-51268035 ATAAACGGTAAATAACAGTGAGG - Intronic
1168677768 19:58291373-58291395 AGGAACAGCAAAGAGCACTGAGG - Intronic
925603587 2:5635187-5635209 AGCAACAGCTAACAGAAGTGGGG + Intergenic
925736980 2:6972141-6972163 AGCAACAGCAAACAGCAGAGTGG + Intronic
926353497 2:12018965-12018987 ATATACAGAAATCGGCAGTGAGG - Intergenic
926361035 2:12087355-12087377 ACATACAGAAAACAGAAGTGAGG - Intergenic
926373201 2:12201274-12201296 ATAAACAGCAAACAGTGATATGG + Intergenic
926394971 2:12431595-12431617 AACAACAACAAACACCAGTGTGG + Intergenic
926495932 2:13588188-13588210 GTAAACAGCAAATAACTGTGTGG - Intergenic
927283517 2:21333007-21333029 TGAAACAGCACACATCAGTGGGG + Intergenic
927719292 2:25372725-25372747 ACAAACACCAACCAGCAGTCAGG + Intergenic
927958259 2:27223446-27223468 ACAAAAAGGAAACAGGAGTGAGG + Intronic
928110663 2:28506358-28506380 ATAAACACCAAGGAGCAGAGAGG + Intronic
928382748 2:30834211-30834233 ACATACAGAAAACAGAAGTGAGG - Intergenic
929261331 2:39869967-39869989 ATAAATATCAAACATCAGTGAGG + Intergenic
929551954 2:42899749-42899771 ATAAACAGCACTCCACAGTGGGG - Intergenic
931585106 2:63817469-63817491 CAAAACAACAAACAGCAATGAGG + Intronic
931806485 2:65812093-65812115 ATGAACAGCAGACAGAAGTGAGG - Intergenic
932676716 2:73788021-73788043 ATGAGAAGCAAACAGCAGAGAGG - Intronic
932677301 2:73792918-73792940 ATGAGAAGCAAACAGCAGAGAGG - Intronic
932677886 2:73797816-73797838 ATGAGAAGCAAACAGCAGAGAGG - Intronic
932678474 2:73802716-73802738 ATGAGAAGCAAACAGCAGAGAGG - Intronic
932679058 2:73807616-73807638 ATGAGAAGCAAACAGCAGAGAGG - Intronic
932749768 2:74363818-74363840 AAAGACACCAAACAGGAGTGAGG + Intronic
932912664 2:75821408-75821430 ACAAAGAGCAGACAGGAGTGAGG + Intergenic
933403525 2:81828879-81828901 ACATACAGAAATCAGCAGTGAGG + Intergenic
934031418 2:88051242-88051264 ATAAAGAGCAAATATCAGTAAGG - Intronic
935546373 2:104403694-104403716 ATAAACAACAAACAACATTTTGG - Intergenic
935665776 2:105510854-105510876 ATGGACAGGAAACAGAAGTGGGG - Intergenic
935899673 2:107777945-107777967 ATAAAGAGCAAAACACAGTGTGG + Intergenic
936665787 2:114593890-114593912 AACCGCAGCAAACAGCAGTGAGG - Intronic
938578432 2:132624765-132624787 ATACACTGCACACAGCAGTGAGG - Intronic
939129143 2:138213266-138213288 ACATACAGGAAACAGAAGTGAGG + Intergenic
939678855 2:145105967-145105989 AAAAACAACAAAATGCAGTGTGG + Intergenic
940162951 2:150733375-150733397 AGAAACAGCAAGCAGCAGTGTGG + Intergenic
941318795 2:164029204-164029226 AAAAACAGCGAAAAACAGTGTGG + Intergenic
943337657 2:186637923-186637945 ATACAGAGCAAACTGAAGTGGGG - Intronic
943961661 2:194272160-194272182 ATGTACAGAAAACAGAAGTGAGG + Intergenic
945315507 2:208366950-208366972 ACATACAGAAAACAGAAGTGAGG - Intronic
945695272 2:213094358-213094380 ATAAACTGGCAACAGCAGAGAGG + Intronic
946845846 2:223858425-223858447 ATGAACAGAAATCAGCAGTGAGG - Intronic
947931058 2:233965411-233965433 CTGAATAGCAAACAGCAGTCAGG - Intronic
1169512995 20:6285159-6285181 ACATACAGAAAACAGAAGTGAGG - Intergenic
1169553388 20:6724620-6724642 ATGAACAGAAAACAGAAGTGAGG - Intergenic
1170948966 20:20917147-20917169 ATAATCAGCAAACATCCCTGAGG + Intergenic
1171055199 20:21899880-21899902 AGACACAGAAAACAGAAGTGAGG + Intergenic
1171212835 20:23329771-23329793 AAAAACAGCAAGCCCCAGTGGGG - Intergenic
1171429215 20:25070070-25070092 ACACACAGAAAACAGAAGTGAGG + Intergenic
1171478902 20:25437304-25437326 AGAAACAGCAATCAGCAGTGAGG + Intronic
1172108118 20:32528624-32528646 TTCAATAGCAAACAGCTGTGGGG + Intronic
1172125553 20:32623349-32623371 AAAAAAAGAAAAAAGCAGTGTGG + Intergenic
1172191096 20:33062358-33062380 ATAGACAGCAAAGGGCAGTCAGG + Intronic
1175332487 20:58175092-58175114 ATCCACAGCAAACAGCAGGCAGG + Intergenic
1177076750 21:16584839-16584861 ATAAGGAGCAATCAGCAGTTAGG - Intergenic
1177774303 21:25550854-25550876 AAAATCAGCAAACAGAACTGTGG - Intergenic
1179636576 21:42715005-42715027 AGAAACAGCAAATAGCAACGTGG - Intronic
1181376113 22:22459618-22459640 CTAAACAGCAAACGGCAGACAGG - Intergenic
1182544157 22:31063744-31063766 ACATACAGAAAACAGAAGTGGGG + Intergenic
1183770878 22:39924781-39924803 ATAGACTGCAAAGAGGAGTGAGG + Intronic
949584346 3:5423341-5423363 ACACAAAGCAAACAGCAGGGTGG - Intergenic
949694778 3:6681716-6681738 TTAAACAACAAACTGCTGTGAGG - Intergenic
950152776 3:10700888-10700910 AAAAATAGCAAACAGCATGGTGG + Intronic
950968693 3:17164939-17164961 ATAAACTGCTAACAGCTATGGGG + Intronic
951486341 3:23215704-23215726 ATAAACAGCAAAGAGAAGGGTGG - Intronic
951712266 3:25595496-25595518 GTAAACAGCAGATACCAGTGTGG + Intronic
951990136 3:28667582-28667604 ATAAACAGAAAAGAGGGGTGAGG - Intergenic
952625294 3:35395624-35395646 ATAAACAGCAAAAAATAATGTGG - Intergenic
955757838 3:62243692-62243714 TTAAACATCACACAGCACTGAGG - Intronic
955914196 3:63890358-63890380 ATAAACAGCTAAGAGGAGAGGGG - Intronic
957982976 3:87535833-87535855 ATAAAAAACAAACAACATTGTGG + Intergenic
958092060 3:88889453-88889475 ATTAACAGCCATCAGCATTGAGG + Intergenic
958096475 3:88951973-88951995 ATAAGCAGCCATCAGCATTGAGG + Intergenic
960620352 3:119631055-119631077 AAAAAAAGCAACGAGCAGTGGGG - Intergenic
961201432 3:125048787-125048809 AACAACAGAAAAGAGCAGTGGGG + Intronic
961790537 3:129373277-129373299 ATGTACAGAAAACAGAAGTGAGG + Intergenic
962172582 3:133117825-133117847 AGAAACAGCAGCCAGCAATGGGG - Intronic
962701324 3:138002441-138002463 TTAAACAGAAAACAGAATTGGGG - Intronic
963974502 3:151465997-151466019 ATATACAGAAATCAGAAGTGAGG - Intergenic
964981267 3:162684230-162684252 ATAACCTAGAAACAGCAGTGAGG - Intergenic
966316070 3:178646505-178646527 ATAAAAGGGAAACAGCTGTGGGG + Intronic
969787405 4:9469785-9469807 AAAATCAGCAAACAGCAGACAGG - Intergenic
970269844 4:14334358-14334380 AAAAACAGCAGATACCAGTGAGG + Intergenic
970301904 4:14690653-14690675 ATCAACAGCAAATACCATTGAGG + Intergenic
970540552 4:17074088-17074110 AGAAACAGCAGAGACCAGTGGGG - Intergenic
970578297 4:17448929-17448951 ACACACAGGAAACAGAAGTGAGG + Intergenic
971425768 4:26513797-26513819 AAAAATAGCAAATACCAGTGAGG - Intergenic
972744364 4:41919141-41919163 ATTTACAGAAAACAGAAGTGAGG - Intergenic
974980226 4:68947013-68947035 ATCAACAGTAATCAGCACTGAGG - Intronic
974980812 4:68955200-68955222 AGAAACAGGACACAGCAGTAAGG + Intergenic
975010157 4:69340811-69340833 AGAAACTGGACACAGCAGTGAGG - Intronic
975770244 4:77712503-77712525 TGAAACAGAAAACAGCTGTGCGG - Intergenic
976577046 4:86685306-86685328 AAAAACAAAAAACTGCAGTGAGG + Intronic
976807984 4:89069612-89069634 ACACACAGAAAACAGAAGTGAGG - Intronic
977111142 4:92956665-92956687 ATAAATAGCAATGAGCAGTATGG + Intronic
978282670 4:107036318-107036340 ATAAAAAGCAAAGAGGACTGGGG - Intronic
979205960 4:118038275-118038297 ATAAACAGCAAACAGCAGTGGGG + Intronic
979207820 4:118061942-118061964 ACATACAGAAAACAGAAGTGAGG + Intronic
979407319 4:120329133-120329155 ATAGACAGAAAAGAGCATTGAGG + Intergenic
980343034 4:131576858-131576880 ATGGACAGAAAACAGAAGTGAGG - Intergenic
980847974 4:138346778-138346800 GTTAACAGAAAACAGCAATGGGG + Intergenic
981027525 4:140091980-140092002 ATACACTCCAAAAAGCAGTGGGG + Intronic
981471750 4:145143269-145143291 AAAAACAGAAAACATCAGTATGG - Intronic
981817015 4:148842560-148842582 AGAAAGAGCACAAAGCAGTGAGG - Intergenic
981867855 4:149447235-149447257 ACAAACAGCAAATACCAGTAAGG + Intergenic
982201833 4:152968994-152969016 ATCAACAAAAAACAGCAGAGTGG + Intronic
983193682 4:164781826-164781848 AGAAACAGAAAACAGCACAGTGG + Intergenic
983567633 4:169171213-169171235 ATTCACAGAAAACAGAAGTGAGG - Intronic
984647646 4:182236788-182236810 ATACACAGCAAATCTCAGTGGGG - Intronic
984716116 4:182926833-182926855 AAAGACAGAAAACAGCACTGTGG + Intergenic
984860539 4:184233992-184234014 ATGTACAGAAAACAGAAGTGAGG + Intergenic
985168682 4:187125236-187125258 AGGAACAGAAAACAGAAGTGAGG + Intergenic
985859007 5:2455538-2455560 ACAAACAAAAAACAGCAGAGGGG - Intergenic
987057505 5:14208801-14208823 ATGAACAGAAAATAGAAGTGAGG - Intronic
988135970 5:27172299-27172321 ATAAAAAACAAACATCACTGGGG + Intergenic
988548435 5:32178617-32178639 AAAAACAAAAATCAGCAGTGTGG - Intergenic
988733858 5:34001344-34001366 ATGTACAGAAAACAGAAGTGAGG + Intronic
990290439 5:54345384-54345406 ATGTACAGAAATCAGCAGTGAGG - Intergenic
990290982 5:54351395-54351417 ATGTACAGAAATCAGCAGTGAGG - Intergenic
991092728 5:62708669-62708691 ATAGGCAGCAAACAGCTATGAGG + Intergenic
991124159 5:63050888-63050910 ACACTCAGAAAACAGCAGTGTGG + Intergenic
991220619 5:64211292-64211314 ATAGGCAGCAAACAGCCATGAGG + Intronic
991563284 5:67977736-67977758 ATAAACAGCAAGCATTGGTGTGG + Intergenic
991563807 5:67983856-67983878 ATATACAGAAAACAGAAGTGAGG - Intergenic
994211670 5:97094212-97094234 ATACACTGCAAACTACAGTGGGG - Exonic
995039535 5:107572005-107572027 AGAAACTGCAAACAGCAGCGTGG + Intronic
997801526 5:136867434-136867456 TCAAACAGCTAACAGAAGTGAGG + Intergenic
998536316 5:142934412-142934434 CTAAAAAGCACACAGAAGTGTGG - Intronic
999105920 5:149071117-149071139 ACAGACAGAAAACAGAAGTGAGG - Intergenic
1001186158 5:169574836-169574858 ATAAAGAGCCACCAGCAGTATGG - Intergenic
1002490348 5:179571663-179571685 ATATACACCCACCAGCAGTGTGG + Intronic
1004330190 6:14714164-14714186 ATGGACAGGAAACAGAAGTGAGG + Intergenic
1004460348 6:15829360-15829382 ATGTACAGAAAACAGAAGTGAGG + Intergenic
1004976937 6:20978529-20978551 ATAAACAGGAAACAGATGTTAGG + Intronic
1005040136 6:21594241-21594263 AGAGACAGCAAACTGCAGCGCGG + Exonic
1005971374 6:30764480-30764502 AAAAACAGGAAGCAGCAGGGAGG + Intergenic
1006290554 6:33132366-33132388 ACATACAGAAAACAGAAGTGAGG + Intergenic
1006291388 6:33139907-33139929 ACATACAGAAAACAGAAGTGAGG + Intergenic
1009719834 6:67453977-67453999 AAAAAAGGTAAACAGCAGTGGGG + Intergenic
1012260042 6:97077772-97077794 AAAAAAAGCAAACAGTTGTGAGG - Intronic
1014768322 6:125433100-125433122 ATGTACAGAAAACAGAAGTGAGG + Intergenic
1017053935 6:150421018-150421040 ACACACAGAAAACAGAAGTGAGG - Intergenic
1018332885 6:162750596-162750618 TTAAACTGTAAACAGCATTGTGG - Intronic
1018491660 6:164300075-164300097 ATGTACAGAAAACAGAAGTGAGG - Intergenic
1018717955 6:166549165-166549187 ATAAACATCAAACATCGGTGAGG + Intronic
1018986560 6:168642244-168642266 ATGGACAGAAAACAGAAGTGAGG + Intronic
1019252848 7:28563-28585 ACATACAGAAAACAGAAGTGAGG - Intergenic
1020169493 7:5833944-5833966 ATAAAATGCAAACAGAAGTCAGG + Intergenic
1022216390 7:28266501-28266523 ATAGACAGAAAACAGAAATGAGG + Intergenic
1022222413 7:28326472-28326494 GTTAATATCAAACAGCAGTGGGG - Intronic
1023580329 7:41675441-41675463 ATGTACAGAAAACAGAAGTGAGG + Intergenic
1023593804 7:41807521-41807543 ACATACAGAAAACAGAAGTGGGG + Intergenic
1024023893 7:45395123-45395145 AGAAACTCCAAGCAGCAGTGTGG + Intergenic
1024267388 7:47617311-47617333 ACATACAGAAAACAGAAGTGAGG + Intergenic
1025033641 7:55577014-55577036 ATCTACAGAAAACAGAAGTGAGG - Intergenic
1027059280 7:75073091-75073113 ATAAACAGCTAGCAGCGGTGGGG + Intronic
1027569809 7:79851290-79851312 ATAAAACTCAAACAGCAATGAGG + Intergenic
1028737847 7:94237697-94237719 ATGTACAGAAAACAGAAGTGAGG - Intergenic
1028975603 7:96909878-96909900 ATAGATAGAAAACAGCACTGAGG + Intergenic
1029289455 7:99491011-99491033 ATCATCAGGAAACAGCAGTCAGG - Intronic
1029661202 7:101963265-101963287 ATGAGCAGAAAACATCAGTGAGG - Intronic
1030661801 7:112227421-112227443 ATGGACAGAAAACAGAAGTGAGG + Intronic
1031770399 7:125834123-125834145 ATGTACAGAAAACAGAAGTGAGG - Intergenic
1031869806 7:127079507-127079529 ACAAATAGAAAATAGCAGTGAGG + Intronic
1032809841 7:135401598-135401620 TTGTACAGCAAAAAGCAGTGGGG + Intronic
1034864808 7:154632047-154632069 ATGTACAGAAAACAGAAGTGAGG + Intronic
1034951538 7:155299914-155299936 GAAAACAGCAAGCAGCAGAGAGG + Intronic
1035408217 7:158615020-158615042 ATAAACAGCTAAGACCAATGAGG + Intergenic
1035429451 7:158807632-158807654 TGTAACAGCAAACAGCAGTGAGG - Intronic
1037412219 8:18610433-18610455 ACATACAGAAATCAGCAGTGAGG - Intronic
1037860832 8:22404448-22404470 AAAAAAAACAAACAGCAATGCGG - Intronic
1039688542 8:39836363-39836385 TTAAATAGAAAAAAGCAGTGAGG - Intronic
1040056337 8:43060823-43060845 TTAAAAAGCAAGCAGCAGTGTGG + Intronic
1040626210 8:49152170-49152192 ATCAACATCATCCAGCAGTGTGG + Intergenic
1040802672 8:51360821-51360843 ATGTACAGAAAACAGAAGTGAGG - Intronic
1041936783 8:63340896-63340918 ATAGTCAGCAAACAGCTATGAGG + Intergenic
1042184302 8:66121681-66121703 ATATACAGAAAACAGAAGTGAGG - Intergenic
1042781816 8:72499372-72499394 GTAAAAGGCAAACAGCAGTCTGG - Intergenic
1044260721 8:90117248-90117270 ATGACCAGAAAACAGAAGTGAGG + Intergenic
1044705533 8:95004754-95004776 AAAAACAGAAAAGAGAAGTGAGG + Intronic
1044751326 8:95418921-95418943 AGATACAGAAAACAGAAGTGAGG + Intergenic
1045530413 8:102979841-102979863 ATGTACAGAAATCAGCAGTGAGG + Intergenic
1046658977 8:116928053-116928075 ATGTACAGAAAACAGAAGTGAGG + Intergenic
1046786502 8:118272331-118272353 TGAGACAGCACACAGCAGTGGGG + Intronic
1047778393 8:128092174-128092196 ATAAATGGGAAACAGCAGGGGGG - Intergenic
1047824194 8:128555364-128555386 ATATACGGGAAACAGAAGTGTGG - Intergenic
1048393845 8:133994165-133994187 AGAAACAGCAACCAGCCCTGAGG + Intergenic
1049022305 8:139965868-139965890 ATCACCAATAAACAGCAGTGAGG + Intronic
1049139357 8:140938448-140938470 ACAGACAGCAAAAAGGAGTGGGG - Intronic
1050086527 9:1972086-1972108 CTAAACTGCACACAGCAGGGGGG - Intergenic
1053787257 9:41661154-41661176 ACACAGAGGAAACAGCAGTGAGG + Intergenic
1054933960 9:70667087-70667109 ATAAACAGCGAGATGCAGTGTGG - Intronic
1055052287 9:71992868-71992890 ACATACAGAAATCAGCAGTGAGG - Intergenic
1056424207 9:86460353-86460375 ATATACAGAAACCAGCAGTGAGG - Intergenic
1056543493 9:87594283-87594305 ACAAACAGCAAGCAGCAGGCAGG + Intronic
1056653513 9:88489544-88489566 ATGAACAGAAAACAGAAATGAGG + Intergenic
1056679896 9:88708032-88708054 ATCAACTGTAAACAGCAGAGAGG + Intergenic
1057417228 9:94875471-94875493 ATACACAGAAAACAGAAGTAAGG + Intronic
1058370094 9:104256402-104256424 AGATACAGCACACAGCAGTAAGG + Intergenic
1061341786 9:129988121-129988143 GGAAACAGAAAGCAGCAGTGAGG + Intronic
1062747522 9:138223811-138223833 ACATACAGAAAACAGAAGTGAGG + Intergenic
1186207503 X:7215858-7215880 AAAGACAGCTAACAGCAGTGTGG - Intergenic
1187686084 X:21816997-21817019 ATAAACAGCAGAGAGCAGAAAGG + Intergenic
1187936775 X:24343883-24343905 ATACACAGAAAACGGAAGTGAGG + Intergenic
1188114778 X:26229535-26229557 ATAAAATGCAAATATCAGTGAGG - Intergenic
1188157028 X:26752709-26752731 ATGAACAGAAAACAGAAGTAAGG + Intergenic
1190191458 X:48280524-48280546 AAAAACAGCAAAAGGCAGGGTGG - Intergenic
1190286515 X:48965038-48965060 AAAAAAAGCATACAGCAGGGTGG - Intronic
1190578051 X:51861083-51861105 ATAAAAAGCAAACAGTGGGGCGG + Intronic
1191591084 X:62886038-62886060 ACAAACAACAAAAAGCAATGAGG + Intergenic
1191776229 X:64816873-64816895 AGAAACAACTAAGAGCAGTGCGG + Intergenic
1192335594 X:70216823-70216845 TTAGACTGCACACAGCAGTGGGG - Intergenic
1192785672 X:74332660-74332682 GTAAACAAGAAACAGAAGTGGGG - Intergenic
1193521408 X:82534227-82534249 ATATACAGCCTTCAGCAGTGAGG + Intergenic
1194051406 X:89073692-89073714 ACATACAGAAAACAGAAGTGAGG + Intergenic
1194291462 X:92077568-92077590 ATAAGCAGCTAACAGGAATGAGG - Intronic
1194304383 X:92224604-92224626 AGACACAGGAAACAGAAGTGAGG - Intronic
1196706966 X:118725331-118725353 AAAAAAAACAAACGGCAGTGTGG - Intergenic
1197143342 X:123141424-123141446 AGAAACAGCATAAAGCAGTGGGG + Intergenic
1198104605 X:133450398-133450420 ACATACAGAAAACAGAAGTGAGG - Intergenic
1199225997 X:145375431-145375453 ATAAATAGCAAACAAAGGTGTGG + Intergenic
1200020216 X:153197303-153197325 ATAAACAGCAGACATTATTGAGG + Intergenic
1200342086 X:155408641-155408663 ATAGACTGCATACAGCAGAGGGG - Intergenic
1201579350 Y:15494524-15494546 AAAGACAGCTAACATCAGTGTGG - Intergenic
1201908066 Y:19105435-19105457 ACAAAAACCAAACATCAGTGGGG - Intergenic