ID: 979205962

View in Genome Browser
Species Human (GRCh38)
Location 4:118038304-118038326
Sequence TCTTCTCTTGCATCACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979205954_979205962 30 Left 979205954 4:118038251-118038273 CCCCCTTAAGTCATATAGGGCAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 979205962 4:118038304-118038326 TCTTCTCTTGCATCACTGGATGG No data
979205957_979205962 27 Left 979205957 4:118038254-118038276 CCTTAAGTCATATAGGGCAGAAT 0: 1
1: 0
2: 0
3: 9
4: 89
Right 979205962 4:118038304-118038326 TCTTCTCTTGCATCACTGGATGG No data
979205956_979205962 28 Left 979205956 4:118038253-118038275 CCCTTAAGTCATATAGGGCAGAA 0: 1
1: 0
2: 0
3: 5
4: 127
Right 979205962 4:118038304-118038326 TCTTCTCTTGCATCACTGGATGG No data
979205955_979205962 29 Left 979205955 4:118038252-118038274 CCCCTTAAGTCATATAGGGCAGA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 979205962 4:118038304-118038326 TCTTCTCTTGCATCACTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979205962 Original CRISPR TCTTCTCTTGCATCACTGGA TGG Intronic
No off target data available for this crispr