ID: 979210405

View in Genome Browser
Species Human (GRCh38)
Location 4:118094114-118094136
Sequence AAGTTTCAACATATGTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2498
Summary {0: 1, 1: 3, 2: 121, 3: 540, 4: 1833}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979210404_979210405 -9 Left 979210404 4:118094100-118094122 CCACACTGGCAATTAAGTTTCAA 0: 1
1: 6
2: 61
3: 282
4: 758
Right 979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG 0: 1
1: 3
2: 121
3: 540
4: 1833
979210401_979210405 17 Left 979210401 4:118094074-118094096 CCTGAAGGCCTCACTTCTTAATA 0: 1
1: 16
2: 132
3: 597
4: 1754
Right 979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG 0: 1
1: 3
2: 121
3: 540
4: 1833
979210400_979210405 20 Left 979210400 4:118094071-118094093 CCTCCTGAAGGCCTCACTTCTTA 0: 1
1: 10
2: 69
3: 278
4: 988
Right 979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG 0: 1
1: 3
2: 121
3: 540
4: 1833
979210402_979210405 9 Left 979210402 4:118094082-118094104 CCTCACTTCTTAATACTACCACA 0: 6
1: 32
2: 246
3: 789
4: 1856
Right 979210405 4:118094114-118094136 AAGTTTCAACATATGTATTGTGG 0: 1
1: 3
2: 121
3: 540
4: 1833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979210405 Original CRISPR AAGTTTCAACATATGTATTG TGG Intronic
Too many off-targets to display for this crispr