ID: 979211855

View in Genome Browser
Species Human (GRCh38)
Location 4:118114240-118114262
Sequence TAGGGAAAACTGAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979211855 Original CRISPR TAGGGAAAACTGAAGGATGA AGG (reversed) Intronic
900993508 1:6108471-6108493 GAGGGAGAATGGAAGGATGATGG + Intronic
901246149 1:7732818-7732840 TAGAGATAACTTAAGGATTAGGG - Intronic
902868765 1:19299489-19299511 TATGAAAGACTGAAGGAGGAGGG - Intergenic
903675857 1:25064126-25064148 TGGGAAAAAGTGAAGGCTGAGGG + Intergenic
904291314 1:29487831-29487853 TAGAGGAAACTGATGGAAGAAGG + Intergenic
904663984 1:32105986-32106008 AAAGGAAAACTCTAGGATGAAGG - Intergenic
905606854 1:39308639-39308661 AAAAGAAAACTGAAGTATGAAGG - Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906166022 1:43686935-43686957 TTGTGAATACTGAATGATGAGGG - Intronic
907878109 1:58514910-58514932 TAGGTAAACCTGAGGGATGGAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907993709 1:59608216-59608238 TGGGGAAAACTGAAGGATTTGGG - Intronic
908704043 1:66930842-66930864 TGGGGAAAACGTAAGGCTGACGG + Intronic
909381131 1:74999914-74999936 TAGGAAAAACTGAGGGCTAAAGG - Intergenic
909544393 1:76829009-76829031 TGGGGTAAAATGAATGATGATGG - Intergenic
909779475 1:79524809-79524831 TGAGGAAAACGGAAAGATGAAGG + Intergenic
909836199 1:80258655-80258677 CAGGGAAAATTGAAAGATCATGG + Intergenic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
911028711 1:93462868-93462890 TAGCGAAAACTGAAGGAGAGGGG + Intronic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
914429477 1:147607757-147607779 TATGGAAAACTGAAGGAAAAAGG + Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915987569 1:160481767-160481789 GAGGGAAACCTCAAGGGTGATGG + Intergenic
916185917 1:162132793-162132815 TGGGGAAAACTGAAGGAGTGTGG - Intronic
916900653 1:169218982-169219004 TAGGGAAACTTGAAGGCAGATGG + Intronic
917665915 1:177225504-177225526 AAGGAAAAACTGAAGCACGATGG + Intronic
919138838 1:193544601-193544623 AAGGGAAAACTGAAGGAAACAGG + Intergenic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922955452 1:229595508-229595530 CAGCTAAAACTGATGGATGAAGG - Intronic
922959302 1:229632417-229632439 TAGGGAAATCTGAAGATTAATGG - Exonic
924077379 1:240354283-240354305 TAGGGCCAACTGAAGAATGGAGG + Intronic
924202593 1:241675140-241675162 TAGGGAAGAAGGAAGGAAGAAGG - Intronic
1064402582 10:15033944-15033966 TAGGGAGAAAGGAAGGAAGAAGG + Intronic
1064513383 10:16119772-16119794 TAAGGAAAACTGAAGAAGGAAGG - Intergenic
1065305784 10:24367239-24367261 GAGGGAAAGGTGCAGGATGAGGG - Intronic
1065770517 10:29074055-29074077 GAGGGAAGAATGAAGGAAGAAGG + Intergenic
1069178137 10:65320816-65320838 ATGTGAAAACTGAAGGGTGATGG - Intergenic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1071385026 10:85111219-85111241 TTGGGAAAACTGAAGGCCGAAGG + Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071818516 10:89256078-89256100 TGTGGAAGACTGAAGGAAGAAGG - Intronic
1073624002 10:105077395-105077417 TGGGGAAACCAGAAGGATGAAGG + Intronic
1073842775 10:107517069-107517091 TAGGGAAGAATGAAGCAGGATGG - Intergenic
1074219655 10:111423992-111424014 GAGCAAAAACTGAAGGATAAGGG - Intergenic
1074268329 10:111927718-111927740 GAAGGACAACAGAAGGATGAAGG - Intergenic
1079130444 11:17744143-17744165 GTGGAAAAACTGCAGGATGAAGG - Intronic
1079477677 11:20848402-20848424 TAATGAAAATTGAAGAATGAGGG + Intronic
1080076128 11:28151935-28151957 TATTGAAATCTGAAGGAAGAGGG - Intronic
1080979763 11:37387387-37387409 TAGAGAAAACTGATGGATCTGGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081965194 11:47165112-47165134 TAGGGAAAGCGGAAGGTAGAAGG - Exonic
1082271903 11:50181322-50181344 TAGAGAAAACTGAAGGAGAAGGG - Intergenic
1082975715 11:59069930-59069952 TAGGCAAACCTGGCGGATGAAGG + Intergenic
1082980096 11:59113345-59113367 TAGGCAAACCTGGTGGATGAAGG + Intronic
1084559029 11:69892405-69892427 ATGGGAAAACTGAGGCATGAGGG - Intergenic
1085539149 11:77250242-77250264 TTGGGACTACTGAAGGAGGAAGG - Intronic
1085948006 11:81295614-81295636 TGGGGCAGAGTGAAGGATGAGGG + Intergenic
1086508661 11:87531720-87531742 TAGGGAAAACAAATGGATAAGGG - Intergenic
1086599596 11:88616620-88616642 TTAGGAAAAATGAAGAATGAAGG + Intronic
1086890170 11:92248125-92248147 GAGGGAAAAAGGAAAGATGAGGG - Intergenic
1087302259 11:96449402-96449424 TAGGGGAAACTGAAGGCTTGAGG - Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088224826 11:107608227-107608249 TAGGGAAACCTAAAGGACCATGG + Intronic
1089498156 11:118918154-118918176 TAGGGAAAGCTGGAGGAAGCTGG - Intronic
1089512995 11:119012366-119012388 TAGGGAACAGTGAAGGAAGAAGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089862057 11:121598343-121598365 TAAGGAAAAAGGAAGAATGAGGG + Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092322912 12:7497481-7497503 GGAGGCAAACTGAAGGATGAGGG - Intronic
1093146252 12:15570233-15570255 TATAGAAACCTGAAGGATGGGGG - Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1095091419 12:38110531-38110553 TTAGGAAAACTCAAGGATTAAGG + Intergenic
1095767115 12:45909370-45909392 TTGGGAAATCTGAAGAATTATGG - Intergenic
1095861462 12:46922531-46922553 TAGGGAAGACTCAGAGATGAAGG - Intergenic
1096795013 12:54071341-54071363 AAGCAAAAACTGAAGGATGCTGG + Intergenic
1097075182 12:56387790-56387812 TAGGGAAAACTGAGGGGTGTGGG - Intergenic
1097357992 12:58623446-58623468 TAGGGGAAACAGAACAATGAAGG - Intronic
1097461170 12:59863738-59863760 TAGGGAAAATGGAAGAATCAGGG - Intergenic
1097842624 12:64336827-64336849 GAGGGAGAAGGGAAGGATGAAGG - Intronic
1097946357 12:65373086-65373108 GAAGAAAAAGTGAAGGATGAGGG + Intronic
1098331143 12:69354866-69354888 TAGGGCAGACTGTAGAATGATGG - Intergenic
1098521368 12:71438358-71438380 TAGGGAAAAGTGAAGGAAAAGGG + Intronic
1099148186 12:79074602-79074624 TAAGCAAAACTCAAGAATGAAGG - Intronic
1099410273 12:82316931-82316953 TAGCAAAAGCTGAAGAATGAAGG + Intronic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1101153803 12:101908570-101908592 AAAGGAAACCTCAAGGATGAGGG + Intronic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1101887230 12:108676012-108676034 TAGGGAAAAGAAAATGATGAAGG + Intronic
1102234297 12:111284608-111284630 AAGGGAAAACTGAAGCTTAAAGG + Intronic
1102798153 12:115707367-115707389 TAGGGAAAACTGAGGCTAGAAGG - Intergenic
1103058911 12:117843200-117843222 AAGGGAACACCGAGGGATGAAGG + Intronic
1105445173 13:20447626-20447648 AAGGGAAAACTGAAAGCTAAAGG + Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1108452263 13:50578948-50578970 TGGGGAAAACCAAAGAATGATGG + Intronic
1109992533 13:70077663-70077685 TAGGGGAAATTGGAGGATAATGG + Intronic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111351804 13:87041201-87041223 TAGGGAAAAATGAAGGGAAAGGG - Intergenic
1112433310 13:99372381-99372403 GGGGGGAAAATGAAGGATGATGG + Intronic
1112911104 13:104484902-104484924 TAGGTAGAACTGAAGGAACATGG - Intergenic
1113046138 13:106157448-106157470 GAGGAAAAAGTGGAGGATGAGGG + Intergenic
1115160451 14:30387928-30387950 TAGAGACAAGTCAAGGATGATGG - Intergenic
1115176968 14:30574194-30574216 TAGGAAATACTGAAGCATTAAGG - Intronic
1115374942 14:32664435-32664457 TAGAGAAAACTGAAGAATATTGG + Intronic
1116319002 14:43435653-43435675 TAGGGAAAAGGGAAGGGTGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117359333 14:54957999-54958021 TAGGGAAAAGTCAAAGATGTAGG - Intronic
1118173468 14:63412740-63412762 TGGGGATAACTGAATGAAGAGGG + Intronic
1118412157 14:65492266-65492288 TAGGCTAAACTGAAGTAAGAAGG - Intronic
1119727638 14:76931518-76931540 GAGGGAAAAATCAAAGATGAGGG - Intergenic
1120053244 14:79892823-79892845 GATGGAAAAATGGAGGATGAGGG - Intergenic
1121205209 14:92159109-92159131 GAAGGAGAACTAAAGGATGATGG + Exonic
1121902007 14:97701936-97701958 TAAGGACATCTGAAGGTTGATGG + Intergenic
1125076363 15:35623522-35623544 TAGGGAAAGATGAAGAATGGTGG - Intergenic
1125422629 15:39519782-39519804 TAGGGTATAATGAAGCATGATGG - Intergenic
1126834855 15:52651200-52651222 TATAGAAAACTGAAGGATAAGGG - Intronic
1127098892 15:55543040-55543062 TAAGCAAAACTCAAGGATGTTGG + Exonic
1127378471 15:58406920-58406942 TAGGCAAAACGGAAGGACAAGGG + Intronic
1127692532 15:61412188-61412210 GGTGGAAAACTGATGGATGAAGG + Intergenic
1128016074 15:64348390-64348412 TAGGGGAAACTGGGGGATGGAGG + Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1129062836 15:72873986-72874008 TTGGGAAAAGTGACGCATGAGGG - Intergenic
1131211448 15:90500607-90500629 TCAGGAAAACTGAAGGATATGGG + Exonic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132015353 15:98311240-98311262 TAGGGGAAACTGGATGTTGAGGG + Intergenic
1132315163 15:100884729-100884751 TGGTGAAAACTGAAGGGCGATGG + Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1133513745 16:6485814-6485836 TAGGAAAAACAGAAGTTTGAAGG - Intronic
1133862438 16:9609009-9609031 TGGGGAAAACTGAAACCTGAAGG + Intergenic
1134009230 16:10838946-10838968 TAGGGAAAACTGAGGCCTGTGGG + Intergenic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135685857 16:24497932-24497954 TAGGTAAAAATGAAGGTAGAGGG + Intergenic
1138157620 16:54720693-54720715 TGGGGAACACTGAAGGATCCTGG - Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138781637 16:59795735-59795757 TGGGGAAGACTGAAGTGTGAGGG - Intergenic
1138978284 16:62235800-62235822 TAGAGAAAACTGAATGAAAAAGG - Intergenic
1139687530 16:68616082-68616104 TAAGGATGACTGAAGGCTGATGG - Intergenic
1140718373 16:77747827-77747849 TAGCTGAAACTGAAGGCTGATGG - Intergenic
1141399523 16:83734816-83734838 TAGGCAATCCTGATGGATGAGGG + Intronic
1141511404 16:84514486-84514508 TGGGGACACCTGAAGGATGAGGG - Intronic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1143105142 17:4525980-4526002 TAGAGAAAGATGAAGGAAGAAGG + Intronic
1146176202 17:30667884-30667906 GAGGGAAAAGTGGAGGGTGATGG - Intergenic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1146962332 17:36993287-36993309 GGAGGAAAACTGAAGGGTGAGGG - Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148230455 17:45930101-45930123 TACTGAAAACTAAAGGAAGATGG + Intronic
1149153310 17:53595216-53595238 TAGGGAAGAGTGAAGCAAGATGG - Intergenic
1150346085 17:64405771-64405793 TGGGGACAACAGAAGGATGAAGG + Intronic
1150420416 17:65029053-65029075 TGGTGAACACTGAAGGATCAAGG + Intronic
1150443716 17:65212286-65212308 CAGGGAAAGTTGAAGAATGAGGG + Intronic
1151428909 17:74049512-74049534 TAGCGTAAGCTGCAGGATGAGGG - Intergenic
1151455688 17:74224529-74224551 TAGGGAAAACTCAAGGTGGAAGG + Intronic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155986740 18:32238220-32238242 AAGGGGAAGCTGAAGAATGATGG + Intronic
1156354843 18:36332061-36332083 AAGGGAACACTGCAGGAGGAAGG - Intronic
1157842661 18:50973764-50973786 AAGGGGAAACTGAGGGGTGAGGG - Intronic
1158776250 18:60583579-60583601 GAGTGAAAAAGGAAGGATGACGG - Intergenic
1159406001 18:68003780-68003802 TATGGAAAACTGAGGCAGGAGGG - Intergenic
1160280667 18:77487027-77487049 TAGGATAAATTGAAGGATGCAGG - Intergenic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1161886305 19:6998833-6998855 AATGGAAAACAGAAAGATGAAGG - Intergenic
1162243740 19:9381206-9381228 AAGGGAAGACTGAAAAATGAAGG - Exonic
1162982618 19:14249022-14249044 GAGGGAAAAGTGGAGGGTGATGG + Intergenic
1166052761 19:40270187-40270209 TAGGGGAAAATGAAGGGTAAGGG - Intronic
1168682569 19:58326798-58326820 GAGGGAAATGTGAAGGCTGAGGG - Intergenic
925631972 2:5903663-5903685 AAGGCAAAATTGAAGCATGAAGG + Intergenic
926024110 2:9524783-9524805 TTGGGAAAACTGGAGAAGGAAGG + Intronic
926385729 2:12334050-12334072 AAAGGAATACTGAAGGGTGAGGG - Intergenic
926872611 2:17439941-17439963 TAGGTAAAAGTGAAGGATAATGG + Intergenic
927070430 2:19523199-19523221 TAGGGAACCTTGAAGGAAGAAGG + Intergenic
927085320 2:19669432-19669454 ATGGCAACACTGAAGGATGATGG + Intergenic
927245295 2:20952568-20952590 TAGGGAAAAGTGAATGATTTGGG - Intergenic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
929640621 2:43575476-43575498 TAGGGAAATTTGGGGGATGATGG + Intronic
931277935 2:60760582-60760604 AAGGGAAAATTTAAAGATGAAGG + Intronic
931899557 2:66772463-66772485 TAGGGAAAACTGATGAAAGGAGG + Intergenic
932705783 2:74023949-74023971 TAGGAAAAACTGAATCAGGAGGG - Intronic
934504295 2:94879220-94879242 CAGGGAAAACTGAGGCCTGAGGG + Intergenic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935972539 2:108544258-108544280 TAGGGAAAATTCAAGAATCAGGG + Intronic
936166974 2:110129417-110129439 TAGGGGCAAATGAAGGTTGAAGG - Intronic
937005511 2:118509099-118509121 GAGGGATAGCTGAAGGATGTGGG + Intergenic
937071319 2:119065896-119065918 TAGGGCAATATGAAGGATGAAGG - Intergenic
937900773 2:127017384-127017406 TGAGGAAAACTGAAGGACAAAGG + Intergenic
937989163 2:127652910-127652932 TGGGGAAATCTGAAAGATGCTGG - Intronic
939559025 2:143712076-143712098 TAGGGAAAACAGTAGAATGCTGG + Intronic
939817265 2:146911342-146911364 TAGGACAAAAGGAAGGATGAAGG + Intergenic
940306769 2:152235251-152235273 TACAGAAAGCTGAGGGATGAAGG + Intergenic
941412014 2:165169953-165169975 AAGGGAAAAGGGAAGAATGAAGG + Intronic
941601326 2:167546925-167546947 CAAGGGAAAGTGAAGGATGAGGG - Intergenic
941684610 2:168435805-168435827 TAGGGAAAACAGTAAGATCAAGG - Intergenic
942512703 2:176719063-176719085 TAGAGAATACTGGGGGATGAGGG + Intergenic
943015187 2:182501842-182501864 GAGGGAAAACTGGAGCTTGAGGG - Intronic
943374717 2:187062128-187062150 TAGGTATAACTTAGGGATGAGGG + Intergenic
945284895 2:208072412-208072434 TCAGGAAAGCTGAAGGCTGAAGG - Intergenic
945376775 2:209086296-209086318 TCGAGAAAACTGAAATATGAAGG - Intergenic
946939078 2:224752171-224752193 TAGGGAATTATGACGGATGAGGG + Intergenic
947508952 2:230733220-230733242 TAGGGCAAATTGGAGAATGAAGG - Intronic
947955234 2:234184152-234184174 GAGGGAAAAGTGAAGCATCAGGG - Intergenic
948096597 2:235339941-235339963 TATGGAAAACTGAGGGAAGGTGG - Intergenic
949063186 2:241973437-241973459 TATGGAAAACTACAGGATAAAGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1170105829 20:12753716-12753738 CAGGAAACACTGAAGCATGAGGG - Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1173269260 20:41517047-41517069 TAGGGACATATGAAGGGTGACGG - Intronic
1174794468 20:53510697-53510719 TAGGGGAAGCTGAAGGGTGAGGG - Intergenic
1177746087 21:25214673-25214695 TAAGGAAACGTGAAGGATAAAGG - Intergenic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1183767927 22:39896541-39896563 TAGAGATAACTGAAAGAAGAGGG + Intergenic
1184949900 22:47833873-47833895 TAGGGACAAAGGAGGGATGAAGG + Intergenic
951144475 3:19210773-19210795 GAGATAAAAATGAAGGATGATGG + Intronic
951647473 3:24908892-24908914 TATGGATAGCTGAAGGATGTGGG - Intergenic
952742303 3:36746477-36746499 GTAGGAAAACTGAGGGATGAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
954856977 3:53652523-53652545 TAGGGAAAAGAGAAAGATCAGGG + Intronic
955274763 3:57536626-57536648 TAGGGAGAAATGATGGATGAAGG - Intronic
955514621 3:59714396-59714418 TGTGGAAAACTGAGGGGTGATGG + Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
957200863 3:77134485-77134507 AAGGAGAAACTGAAGGATAAAGG + Intronic
957670640 3:83296964-83296986 TAGGCAAAAATGATGGATAAGGG + Intergenic
957954110 3:87161480-87161502 TCAGGAGAACTGAGGGATGAGGG - Intergenic
958031287 3:88114208-88114230 TAGAGAAAAATAAAGGAGGATGG + Intronic
958435400 3:94089649-94089671 TAAGGAAGAATGAAGGAAGAGGG + Intronic
959944889 3:112115878-112115900 TAGGGAAGGGTGAGGGATGATGG - Intronic
961200301 3:125040248-125040270 AAGGGAAAAATCAAGGATCAAGG + Intronic
961530390 3:127536881-127536903 TGGGGGAAGCTGAAGCATGAAGG - Intergenic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
962867568 3:139460376-139460398 TAGGGAAATATAAAGCATGATGG - Intronic
963298857 3:143577251-143577273 TAGTGAGAAATGGAGGATGAGGG - Intronic
964270956 3:154956306-154956328 TAGTGGAAACTGAATGATAAAGG + Intergenic
964828315 3:160854421-160854443 TAGGGAACAGTGAAGGATAAGGG + Intronic
965224186 3:165966682-165966704 TAGGGAAAAGGGAAGCCTGAGGG - Intergenic
965278675 3:166720604-166720626 TAGGGATTCCTCAAGGATGAGGG + Intergenic
965679254 3:171233606-171233628 TGGAGAAAGGTGAAGGATGATGG + Intronic
966860240 3:184227657-184227679 TAGGGCACCCTGCAGGATGAGGG - Intronic
967335632 3:188341224-188341246 TAGGAAAAACTGAAGTAGAAAGG + Intronic
968817195 4:2828270-2828292 CAGGGAAAATGGAAGGATCAAGG - Intronic
970589015 4:17542834-17542856 TAGAGATAACAGAAGAATGAAGG + Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG + Intergenic
971402786 4:26292206-26292228 TAGGGAAAATGGAAAGATGTTGG - Intronic
971762932 4:30791595-30791617 TAGAGAATATTGAAGGATCAGGG - Intronic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
973112369 4:46412051-46412073 GTGGGAAAACTGAAGGTTGTTGG + Intronic
973723165 4:53745800-53745822 TAAGGAAAACTGTATGAAGATGG - Intronic
974593597 4:63987644-63987666 TAGGGATAATTGAATCATGAGGG + Intergenic
974927363 4:68316796-68316818 AAGGGAAAACTGAAGCAACAAGG + Intronic
975667623 4:76748618-76748640 TAGGGAAATATGAGAGATGACGG - Intronic
977122832 4:93125766-93125788 AAAGGAAAAGTGAAAGATGAAGG + Intronic
977251457 4:94693542-94693564 TAGGCAAAACTGCTGGATGAAGG + Intergenic
977925158 4:102692315-102692337 TAGGGAAAGAAGAAAGATGAGGG + Intronic
978832799 4:113109679-113109701 TAGGCAAAACTGAAGGAAAATGG - Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
980182727 4:129421912-129421934 CAGCGAAATCTGATGGATGAAGG + Intergenic
980328975 4:131386698-131386720 TTGGGAAAAATGAAGCATTAGGG - Intergenic
980794199 4:137659805-137659827 GCAGGAAAACTTAAGGATGAGGG + Intergenic
980989564 4:139727783-139727805 GAGGGAAAACAGAAGGATTTGGG - Intronic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
983426395 4:167589094-167589116 TAGAGAATAGTGGAGGATGAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986825174 5:11512595-11512617 TTGGGAAAATTGAAGCTTGAAGG - Intronic
986961116 5:13214144-13214166 TAGATAAAACAGAAGGATAAGGG - Intergenic
989197970 5:38734313-38734335 TATGGAAAAGTGAAGGAATAAGG + Intergenic
989399210 5:40991262-40991284 TCAGGAAATCTGAAGGATGATGG + Intergenic
990264209 5:54058327-54058349 TAGGAAAAAATGAAGTGTGAGGG - Intronic
990856099 5:60268163-60268185 TAAGGAAAACTGCCAGATGATGG + Intronic
991208052 5:64072678-64072700 TGTGGAAAAGGGAAGGATGAAGG + Intergenic
992787976 5:80187982-80188004 TAGGTAAAACTGAAGGCAGAAGG + Intronic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994432519 5:99685887-99685909 TAGGGAAAAATAAAGGAAGGTGG - Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995762265 5:115576040-115576062 TCTGCAAAATTGAAGGATGAGGG + Intergenic
996371350 5:122756188-122756210 TAGGAAAGGGTGAAGGATGAAGG + Intergenic
996909681 5:128640881-128640903 TAGCCTAGACTGAAGGATGAAGG + Intronic
997170635 5:131716189-131716211 TATGGAAGACAGAAGGAAGAAGG + Intronic
997192532 5:131951328-131951350 TTGGGAAATCTGAAGCAAGAAGG + Exonic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998560318 5:143165457-143165479 TGTGGAAGACTGAAGAATGAGGG - Intronic
998783573 5:145684896-145684918 TAGGAAAAACTGAAGATGGAAGG + Intronic
999254237 5:150200947-150200969 GAGGGAAGCCTCAAGGATGAAGG + Intronic
999521990 5:152360094-152360116 TAGGGAAAATTGAGGGAGCAGGG + Intergenic
1000852709 5:166360100-166360122 TAGGGGACACTGAAGGTTTAAGG - Intergenic
1000900258 5:166904188-166904210 TAGGGAATACTGAATGCAGAAGG + Intergenic
1001432102 5:171670514-171670536 GAGGGAAGAATGAAGGCTGAGGG - Intergenic
1002045470 5:176539353-176539375 TGGGGAAAACAAAAGGTTGAAGG - Intergenic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003735831 6:8876679-8876701 AAAGGAAAACTGGAAGATGATGG + Intergenic
1004545960 6:16598654-16598676 TAAGGACAACTCAAGGATGCTGG + Intronic
1006336780 6:33425199-33425221 TAGGGAAAGGTGATGGCTGAGGG + Intronic
1006895915 6:37470837-37470859 TGGGGCTTACTGAAGGATGAGGG - Intronic
1007450265 6:41936725-41936747 GAAGGAAACCTGAAGGATAACGG + Intronic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1009293778 6:61917715-61917737 TAGGGAAGACTGAGGGAAAAGGG + Intronic
1009474654 6:64075311-64075333 TGGGGAGAACTGAAGGATCATGG + Intronic
1009645446 6:66395661-66395683 TAGGGGAAACTGATGGCTGTAGG + Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1011597016 6:89025814-89025836 AAAGGAAAACTGAAGGAGAAGGG - Intergenic
1011905406 6:92360775-92360797 TAAGGGAAATTTAAGGATGATGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012350123 6:98240109-98240131 GAGGGGAAACTGAAGAGTGATGG - Intergenic
1012637537 6:101563175-101563197 AAGTGAAAACTGAGGCATGAAGG + Intronic
1013652397 6:112208996-112209018 TGGGGAAAAATGAAGGAAAAGGG + Intronic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015798598 6:137037883-137037905 GAGTGAAAATTGAAGGATCAAGG + Intronic
1017347997 6:153406772-153406794 TAGGGAAACAGGAAAGATGAAGG - Intergenic
1018138759 6:160805899-160805921 TAGGGAAATAGGAAAGATGAAGG + Intergenic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1020460377 7:8423559-8423581 TAGTGAAAACTGAATAAAGATGG - Intergenic
1020771335 7:12398880-12398902 TAGGGACTACTGAAGGGGGAAGG + Intronic
1022764328 7:33393775-33393797 GAGGGCTAACTGCAGGATGATGG - Intronic
1023409157 7:39871506-39871528 AAGGGCAAACTGGTGGATGATGG - Intergenic
1024566813 7:50688219-50688241 CTGGGAAAACTGAAAGATGTTGG - Intronic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1025043773 7:55672529-55672551 AAGGGCAAACTGGTGGATGATGG + Intergenic
1025136699 7:56421044-56421066 AAGGGCAAACTGACGGATGATGG + Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1025624138 7:63203442-63203464 TAGAGAAAAATGAAGGAGAAGGG - Intergenic
1026566171 7:71491332-71491354 TAGGAAAAAATGAAGGCTGCTGG - Intronic
1027610967 7:80360127-80360149 GAGGAAAAGCTGAAGGATGCTGG - Intergenic
1028212253 7:88088468-88088490 TGGGGAAAACTAAACGATTAAGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028802003 7:94977081-94977103 TGGGGAAGACTGAAGGATATGGG + Intronic
1028820401 7:95204364-95204386 TAGAGGAAACTGAAGAATAAAGG + Intronic
1029035865 7:97521006-97521028 TCGTTAAAACTGAAGGAAGATGG - Intergenic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037631501 8:20660797-20660819 TAAGGCAAACTTTAGGATGAGGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037812455 8:22095144-22095166 AAGGGAAAAGTGAGGGATGCAGG - Intronic
1038588480 8:28812885-28812907 TAAGGAAAACAGAAAGATGATGG + Intronic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1042183492 8:66114249-66114271 GAAGGAAAACTGGAGGATGCGGG - Intergenic
1042228655 8:66535432-66535454 TAGGGAAAACTAGAAGATGGGGG + Intergenic
1042678151 8:71346466-71346488 TGGGGAAAACTGCAGGGAGAAGG - Intronic
1043920647 8:85979649-85979671 TAGAGAAAATTGATGGTTGAAGG + Intergenic
1045187018 8:99848537-99848559 TAGAAAAAAATGATGGATGATGG - Intronic
1045820165 8:106327978-106328000 GAGGGGAAACTAAAGGATGTGGG + Intronic
1046050300 8:109013945-109013967 TAAAGAAAACTAAAGGATCATGG - Intergenic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1047071342 8:121347382-121347404 TAGGGGAGACTGAAAGAAGAGGG - Intergenic
1047357877 8:124140541-124140563 TTGGAAAAAATGAAGGATAATGG + Intergenic
1048435149 8:134409518-134409540 AAGCTAAAAATGAAGGATGAGGG + Intergenic
1048452298 8:134544086-134544108 TAGGGAAAATTTCAGGGTGAAGG - Intronic
1048590196 8:135814196-135814218 TAGGTGAAACTGGAGTATGAGGG + Intergenic
1050512435 9:6410289-6410311 TAGGGAAAAAGTAAGGAAGAGGG - Intergenic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1051872266 9:21752067-21752089 TAGAGAACACTGGAGGATGGGGG + Intergenic
1051903511 9:22068432-22068454 TAGGGGAAATTGAAGGATCAGGG + Intergenic
1051930501 9:22379672-22379694 TTGGGAAAACTGTAAGAAGAAGG + Intergenic
1052167607 9:25352406-25352428 TAGGGAAAACAGAAATATAAGGG - Intergenic
1052856753 9:33411774-33411796 GAGGGAACACTGAAGAATGTAGG - Intergenic
1053470840 9:38345349-38345371 TAGGCAGAAGGGAAGGATGATGG - Intergenic
1055118240 9:72628226-72628248 AAGGGAAAACTGTAGCATGTGGG + Intronic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1058608262 9:106746826-106746848 GAGGAAAAACTCCAGGATGATGG + Intergenic
1058732566 9:107864394-107864416 TTGGGGGAACTGAAAGATGATGG - Intergenic
1058806186 9:108594344-108594366 ATGAGAAAACTGAGGGATGAGGG - Intergenic
1058841025 9:108909179-108909201 TAGGGAGAGCTTAAGGATAAGGG - Intronic
1059769367 9:117412725-117412747 TAGAGAGATCTAAAGGATGAAGG + Intronic
1061865750 9:133491050-133491072 GAGGAAAAGCTGGAGGATGAGGG + Intergenic
1203744931 Un_GL000218v1:36361-36383 CAGGGAAAACTGAGGCTTGACGG - Intergenic
1203565175 Un_KI270744v1:83123-83145 CAGGGAAAACTGAGGCTTGACGG + Intergenic
1185608695 X:1381439-1381461 TGGGAAAAGCTGCAGGATGAAGG + Intronic
1186560851 X:10611453-10611475 AAGGGCAAATTTAAGGATGATGG + Intronic
1188558343 X:31438086-31438108 AAGGGAAACGTGGAGGATGAAGG - Intronic
1188944565 X:36282705-36282727 TAGGGAAATATGAAAGATAATGG + Intronic
1189194822 X:39143985-39144007 TAAGGAAACCTGAATCATGAGGG + Intergenic
1193393464 X:80956718-80956740 TAGGGAAAAGGAAAGGATTAGGG + Intergenic
1193741842 X:85226391-85226413 TAAGGAAGACAGAAGGATAATGG - Intergenic
1194724281 X:97376146-97376168 TAGCAAAAACTGAGTGATGAAGG - Intronic
1194940947 X:100009472-100009494 TAGGGAAAATAAAAAGATGAGGG - Intergenic
1195275119 X:103274355-103274377 GAGGGACAACTGGAAGATGAGGG - Exonic
1195287624 X:103400951-103400973 TAGGGAAACATGATTGATGATGG - Intergenic
1195308691 X:103609233-103609255 GAGGGACAACTGGAAGATGAGGG + Exonic
1195742050 X:108074768-108074790 ATGGGAAAGCTGAAGCATGACGG + Intronic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1196400317 X:115309380-115309402 TAGGGAAAAGTGAAGAATTTGGG - Intergenic
1197236691 X:124073901-124073923 TAGGGAAAATGGGAGGATAATGG - Intronic
1198302055 X:135343032-135343054 GGGGGAAATCTGGAGGATGAAGG + Exonic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200087808 X:153618222-153618244 TAGTGATAACTTAAGGACGAGGG + Intergenic
1200868134 Y:8067424-8067446 TAGGGAAAACAGAATAAAGATGG + Intergenic
1201425328 Y:13844079-13844101 TGTGGAAAACTGAAGAAAGATGG - Intergenic