ID: 979211896

View in Genome Browser
Species Human (GRCh38)
Location 4:118114784-118114806
Sequence GATAATATTTCCCCCCCTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979211896 Original CRISPR GATAATATTTCCCCCCCTAA AGG Exonic
909932168 1:81508824-81508846 GCAAATATTTCACCCTCTAAAGG - Intronic
913357879 1:117944034-117944056 GATCATATCTCCCACCTTAAAGG + Intronic
915324657 1:155074988-155075010 GATAATAATGCCCCACCTCAGGG - Intergenic
916097933 1:161367704-161367726 GATAATATTTTACCTCCTCAGGG - Exonic
917745174 1:177999839-177999861 GAAAATATGTCCCCCTCAAAGGG + Intergenic
923026739 1:230210284-230210306 GAAAATGGTTTCCCCCCTAAAGG - Intronic
1071958457 10:90784425-90784447 TATAATAATTCCTCCCCTACAGG + Intronic
1072602812 10:96945963-96945985 GGTAAGAATTCCTCCCCTAAAGG - Intronic
1072777216 10:98210784-98210806 GAGACTATTTCCTCACCTAAAGG + Intronic
1078156395 11:8803702-8803724 GATAATATTACCCACCTCAAAGG - Intronic
1079877352 11:25876736-25876758 GCTAATATTTCCCCTTCTCAAGG + Intergenic
1080837419 11:35952609-35952631 GATAATTCTTCCCCCCTTTATGG + Intronic
1083446310 11:62709945-62709967 GCTAATATTTCCGCTCCAAAGGG - Intronic
1084462784 11:69305447-69305469 AATAATAATTCCCCCCCACATGG + Intronic
1085734772 11:79029875-79029897 GATATGATTTCTCCCCATAAAGG - Intronic
1086631331 11:89023242-89023264 GATAACAATTACCCCCCTGATGG - Intronic
1106632038 13:31484659-31484681 GATAAAATATTCCTCCCTAATGG + Intergenic
1107241662 13:38242533-38242555 GATAATTTTTCCCCACAGAATGG - Intergenic
1109088165 13:58003464-58003486 GTTAATGTTTCCCCACCAAAAGG - Intergenic
1110735641 13:78933220-78933242 GATAACATTTTCCCCACAAAAGG - Intergenic
1110802116 13:79710585-79710607 TAGAAAATTTCCCCCCCTCAGGG - Intergenic
1110843768 13:80171121-80171143 CAGAATATTTCCTTCCCTAATGG - Intergenic
1111008799 13:82285364-82285386 GATAGAATTTCAACCCCTAAAGG - Intergenic
1113179578 13:107609707-107609729 CATAAAATTTCCCTCCTTAAAGG + Intronic
1114019308 14:18462781-18462803 GTGAATATTTTCCCTCCTAAAGG - Intergenic
1114026721 14:18534298-18534320 GTGAATATTTTCCCTCCTAAAGG + Intergenic
1117835668 14:59803358-59803380 GATACTAGTTCCCCTCCTGAAGG - Intronic
1119268163 14:73277383-73277405 TACAACATGTCCCCCCCTAATGG + Intronic
1120809269 14:88786371-88786393 GATAAAATTGCCCACCCTTATGG - Intronic
1121161337 14:91744114-91744136 GATTATATTTCCTCCTCTAGAGG + Intronic
1124233557 15:27967521-27967543 GATAATATTTGCCCATTTAAAGG + Intronic
1135609113 16:23849414-23849436 GATCTTCTTTCCCTCCCTAAAGG + Intronic
1135910726 16:26558418-26558440 GATAATAGTCCCTCCCCAAAAGG + Intergenic
1139117139 16:63969127-63969149 GATAATATTTATTCCACTAAGGG + Intergenic
1140069556 16:71637343-71637365 GTTAATATTTCGCCCCCTGAAGG - Intronic
1141138171 16:81480156-81480178 GATAATATTACCTACCCCAAAGG - Intronic
1148682638 17:49483440-49483462 GAGAAGATTTCCCCACCTGATGG + Intergenic
1153607734 18:6851840-6851862 GATTATCTTTCCCCCACTATAGG - Intronic
1159210908 18:65320133-65320155 GATAATATTTTCTCCCCCTATGG - Intergenic
1167781194 19:51600354-51600376 GGTCATATTTCCCCTCCTCAAGG - Intergenic
928207248 2:29294418-29294440 GACAATATCTCCCCACCTAATGG - Intronic
930251443 2:49038932-49038954 GATAACATTTCAAACCCTAACGG + Intronic
930798036 2:55413393-55413415 GATAATGTTTCCCTTCCTGATGG - Intronic
933345692 2:81082724-81082746 AATAATATTTCCCACCTTAGAGG - Intergenic
937385574 2:121428874-121428896 GATAACAGTTCCCACCCTCATGG - Intronic
939350552 2:141032455-141032477 GAAAATATTTCCCACACTACTGG - Intronic
944131935 2:196356223-196356245 GATAATAGTTCCTACCCTAAAGG - Intronic
948364391 2:237445311-237445333 AATAATAATTCCTCCCCTCAAGG + Intergenic
1179969661 21:44827680-44827702 GAAAATAATTCCACCTCTAAGGG + Intergenic
1180443814 22:15393606-15393628 GTGAATATTTTCCCTCCTAAAGG - Intergenic
1180450858 22:15461494-15461516 GTGAATATTTTCCCTCCTAAAGG + Intergenic
1180543542 22:16476743-16476765 TAAAATTTTTCCCCCACTAATGG + Intergenic
1182650420 22:31847036-31847058 GGAAATATTTCACCCCCTCAAGG - Intronic
957365394 3:79215761-79215783 TACAATATTTTCCCCCTTAAAGG + Intronic
959744124 3:109756929-109756951 GTTAATATTGCCTACCCTAAAGG + Intergenic
961124781 3:124407175-124407197 AATAATATTTCCCAGCCTATTGG + Intronic
962090033 3:132233613-132233635 GATAATATTTCCTCCCTCATTGG - Intronic
962985863 3:140535279-140535301 AATAATATTTCCCACCCTAAGGG - Intronic
963394304 3:144712895-144712917 GAAAATATTTATCCTCCTAAAGG - Intergenic
963428543 3:145164331-145164353 GAGGATATTTGCCCCCCTCAAGG - Intergenic
963720860 3:148860523-148860545 GATAACATTTCTGCCCTTAATGG + Intergenic
964008323 3:151858085-151858107 GATAAAATTCCCCCCACAAATGG - Intergenic
969175184 4:5393342-5393364 GATAATAATGCCCTCTCTAATGG - Intronic
971995589 4:33959704-33959726 GATAATATCTCACCCCAGAAAGG + Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
979211896 4:118114784-118114806 GATAATATTTCCCCCCCTAAAGG + Exonic
987911863 5:24157221-24157243 GATAGTATTTGCCACCCTCATGG + Intronic
993394404 5:87365633-87365655 GTTAATTTTTCCCACCATAAGGG + Intronic
994508888 5:100678101-100678123 GACAATATTTCCCCCCAAAGAGG - Intergenic
994840393 5:104917242-104917264 GAGAATATTTCCCCCTCAGATGG + Intergenic
997949328 5:138229644-138229666 AATAATATTTCCCTCCCTCCCGG - Intergenic
1001416697 5:171549870-171549892 GAGAAAATTTCCCTCCGTAAGGG - Intergenic
1008177383 6:48285871-48285893 GATAATATTTGCAAGCCTAATGG - Intergenic
1008701276 6:54103287-54103309 GATAATATCTCACCCCATTAGGG - Intronic
1011344604 6:86354932-86354954 TATAATAGTTCCCCCACTATGGG - Intergenic
1011568852 6:88712110-88712132 GATTAAATTTATCCCCCTAAAGG - Intronic
1013325060 6:109037110-109037132 GACAATCTTTCCCTCCCCAATGG + Intronic
1014828953 6:126078963-126078985 AATACTATTTCCCCCCGAAAGGG - Intergenic
1015013960 6:128387143-128387165 GATAATATTTACGATCCTAAGGG + Intronic
1017036503 6:150271953-150271975 GCTAAAATTTCCTCCCCCAAAGG - Intergenic
1021757758 7:23871181-23871203 GATAATATGTCACACTCTAATGG + Intergenic
1024240781 7:47434030-47434052 GATCATATTTTCCCCCCAAATGG - Intronic
1030199058 7:106883726-106883748 CATTATATTTCCTCCCCAAAAGG - Intronic
1033870736 7:145751215-145751237 GATAATATTTGCCCCCTTCCTGG + Intergenic
1041658981 8:60382678-60382700 AATAATATTTTTCCCCCAAAAGG + Intergenic
1047865463 8:129019333-129019355 GGTAATATTTCGCACCCTTAAGG - Intergenic
1055747778 9:79469334-79469356 TATAACATTTCCTCCCCAAAGGG - Intergenic
1056013310 9:82355302-82355324 GATAATATTTTTCCCCATAGTGG + Intergenic
1056237798 9:84613030-84613052 GATTATATTTCCTTCTCTAAAGG - Intergenic
1061635224 9:131903698-131903720 GATAATATTTGCCACCATACAGG - Intronic
1186003993 X:5047390-5047412 GAAAATATTTCCCATGCTAACGG + Intergenic
1188303215 X:28530674-28530696 CATAATATTTCTTCCCCTATTGG + Intergenic
1192340719 X:70261238-70261260 GATAAAAACTCCCACCCTAATGG + Intergenic
1196365791 X:114922180-114922202 AAAAATATTTCCCCTCCCAATGG - Intergenic
1196659535 X:118255342-118255364 GATAATATTACCTACCCTATAGG - Intergenic
1197305429 X:124835612-124835634 GTTAATATTTCCCATCCTATTGG + Intronic
1199032493 X:143016531-143016553 GATAATATTTGCCAACCTCATGG + Intergenic
1200695151 Y:6352104-6352126 GATAACATTTCCCTCTCTCAGGG - Intergenic
1201040126 Y:9822606-9822628 GATAACATTTCCCTCTCTCAGGG + Intergenic