ID: 979212332

View in Genome Browser
Species Human (GRCh38)
Location 4:118120272-118120294
Sequence GAGTGTGCCACAAGGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979212328_979212332 -6 Left 979212328 4:118120255-118120277 CCAGTTACCAAGAGAGGGAGTGT 0: 1
1: 0
2: 1
3: 16
4: 116
Right 979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 211
979212324_979212332 20 Left 979212324 4:118120229-118120251 CCATTGAAAAGATCAGTTTGTTA 0: 1
1: 0
2: 4
3: 34
4: 302
Right 979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 211
979212327_979212332 -5 Left 979212327 4:118120254-118120276 CCCAGTTACCAAGAGAGGGAGTG 0: 1
1: 1
2: 1
3: 10
4: 145
Right 979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG 0: 1
1: 0
2: 1
3: 10
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979212332 Original CRISPR GAGTGTGCCACAAGGATGCA GGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900386936 1:2414868-2414890 GAGGCTGCCACAGGGAGGCAAGG - Intergenic
900709662 1:4105597-4105619 CAGGGAGCAACAAGGATGCAGGG - Intergenic
901424064 1:9169931-9169953 GAGTTGGCCACCATGATGCAGGG - Intergenic
902448713 1:16483807-16483829 GAGAGTGGAACCAGGATGCAAGG - Intergenic
902468092 1:16630463-16630485 GAGAGTGGAACCAGGATGCAAGG - Intergenic
902506066 1:16939553-16939575 GAGAGTGGAACCAGGATGCAAGG + Intronic
903155047 1:21437212-21437234 GAGAGTGGAACCAGGATGCAAGG + Intergenic
906646637 1:47479819-47479841 GCGTGTGCCACAAAAATGCCAGG + Intergenic
910798050 1:91118429-91118451 GAGTGTGCCACCACCATGCCTGG + Intergenic
917142503 1:171851032-171851054 AAGTGTGCCACAGGTAAGCAAGG + Intronic
917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG + Intergenic
918797249 1:188916714-188916736 TAGTGTGCCAGCAGGATGGATGG - Intergenic
921694360 1:218190627-218190649 GATTTTGCCACAAGGATGGATGG + Intergenic
923016034 1:230127320-230127342 GAGTCTTCCACAGGGATGAAGGG - Intronic
923682946 1:236133701-236133723 GAGTGTGACTTAAGGAAGCATGG + Intergenic
924747699 1:246852572-246852594 CATTCTCCCACAAGGATGCATGG + Intronic
1064391685 10:14947693-14947715 TAGTGAGCCACACAGATGCAAGG - Intronic
1064435032 10:15303967-15303989 GTTTGTGCCACAGGCATGCAGGG + Intronic
1065173336 10:23053386-23053408 GTGTGTGGCAGGAGGATGCAGGG - Intergenic
1065654973 10:27938901-27938923 GAGTATGCCAAAAAGATACAAGG - Intronic
1068795867 10:61079503-61079525 GAGAGTGCCACAGAGATACATGG + Intergenic
1069710145 10:70482800-70482822 GAGAATGTCACAAGGATGAAAGG + Intronic
1072316373 10:94207206-94207228 GAGCGTGCCCCCAGCATGCAAGG + Intronic
1073794652 10:106974536-106974558 AAGAGATCCACAAGGATGCAGGG + Intronic
1075587408 10:123667735-123667757 GAGTGTGCCCCAAGGCTCCTGGG + Intronic
1076626639 10:131824957-131824979 GAGTGAGCCGCAGGGCTGCAGGG + Intergenic
1076763614 10:132618287-132618309 GAGTGTGCTTCACGGATGCAAGG + Intronic
1076802781 10:132839084-132839106 GTGTGTCCCACATGGATGAAGGG - Intronic
1077223476 11:1427467-1427489 GGGTATGCCACGAGGATGCTGGG - Intronic
1078489718 11:11757749-11757771 GAGTTTGTCATAAGGATGCAGGG - Intergenic
1083201073 11:61121438-61121460 GAGGGTGCCAGAAGGAGGGAAGG + Intronic
1086296274 11:85371810-85371832 GTGTGTACCACAAGGAATCACGG - Intronic
1087194594 11:95292901-95292923 CAGTGGGCAACCAGGATGCAAGG - Intergenic
1088720267 11:112586004-112586026 GAGTGTTCCCTAAGGAAGCAGGG + Intergenic
1089292466 11:117445580-117445602 GACTGAGGCACAAGGAGGCAGGG + Intronic
1089600131 11:119608989-119609011 GAGAGTTCCAGAAGGAAGCAGGG - Intergenic
1090457501 11:126862637-126862659 GAGTGTTGCACCAGGAGGCAGGG + Intronic
1090693324 11:129208999-129209021 GAGTATGCCACAAGAAAGAATGG + Intronic
1094076135 12:26475927-26475949 GGGTGGGCCACAAGGAGGAAGGG + Intronic
1096406598 12:51348416-51348438 GAGTGTGCCAGAATGCTGGAGGG - Intergenic
1097134450 12:56839957-56839979 GCCTGTGCCACATTGATGCAAGG + Intergenic
1102383376 12:112486160-112486182 CTGAGTGCCACAGGGATGCAGGG + Intronic
1107129576 13:36880577-36880599 AAGTGTGCCCCAAGGATCCCTGG + Intronic
1107696989 13:43010065-43010087 GGATGTGTCAAAAGGATGCAGGG - Intergenic
1110150371 13:72244824-72244846 GAGAGTGACCCAAGGATCCAAGG + Intergenic
1111328845 13:86735619-86735641 GATTTTTCCCCAAGGATGCAAGG + Intergenic
1111988174 13:95086730-95086752 GAATGAGCCAGAAGGATGGATGG - Intronic
1114634405 14:24179235-24179257 GTGTGTGACATAAGGAAGCACGG + Intronic
1116962868 14:50984963-50984985 GACAGTGCAAAAAGGATGCAGGG - Intronic
1118311425 14:64696390-64696412 CACTGGGCCACAGGGATGCAGGG + Intergenic
1119970221 14:78961909-78961931 GAATGTGTGACAAGGAGGCAAGG + Intronic
1122324148 14:100872770-100872792 CAGTGAGACACAAGGGTGCAGGG - Intergenic
1122989363 14:105229755-105229777 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989462 14:105230163-105230185 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989486 14:105230265-105230287 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989810 14:105231591-105231613 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989932 14:105232101-105232123 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989956 14:105232203-105232225 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989980 14:105232305-105232327 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990028 14:105232509-105232531 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990052 14:105232611-105232633 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990099 14:105232815-105232837 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990169 14:105233121-105233143 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990268 14:105233529-105233551 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990292 14:105233631-105233653 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990391 14:105234039-105234061 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990440 14:105234243-105234265 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990560 14:105234753-105234775 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990607 14:105234957-105234979 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990631 14:105235059-105235081 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990655 14:105235161-105235183 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990679 14:105235263-105235285 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990726 14:105235467-105235489 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990750 14:105235569-105235591 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990797 14:105235773-105235795 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990821 14:105235875-105235897 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990845 14:105235977-105235999 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990965 14:105236487-105236509 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991037 14:105236793-105236815 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991061 14:105236894-105236916 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991085 14:105236996-105237018 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991109 14:105237098-105237120 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991133 14:105237200-105237222 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991228 14:105237608-105237630 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991252 14:105237710-105237732 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991299 14:105237914-105237936 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991323 14:105238016-105238038 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991372 14:105238220-105238242 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991396 14:105238322-105238344 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991420 14:105238424-105238446 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991444 14:105238526-105238548 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991468 14:105238628-105238650 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991492 14:105238730-105238752 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991516 14:105238832-105238854 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991540 14:105238934-105238956 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991589 14:105239138-105239160 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991613 14:105239240-105239262 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991708 14:105239648-105239670 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991732 14:105239750-105239772 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991756 14:105239852-105239874 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991780 14:105239954-105239976 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991804 14:105240056-105240078 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991828 14:105240158-105240180 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991852 14:105240260-105240282 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991899 14:105240464-105240486 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991923 14:105240566-105240588 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991970 14:105240770-105240792 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991994 14:105240872-105240894 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1125884414 15:43218030-43218052 GAGGGGGATACAAGGATGCAAGG - Intronic
1128599701 15:68985612-68985634 GGATGTGCCACCAGCATGCAGGG - Intronic
1131371728 15:91887434-91887456 GGGGGTGCCTCAAGGGTGCAGGG - Intronic
1139384689 16:66558509-66558531 GAGAGGGTCTCAAGGATGCAGGG + Intronic
1140378272 16:74463044-74463066 GAGTGTGCCAGGAGAATGTACGG - Intronic
1141536987 16:84688680-84688702 GTGTGTGCCACCATGATGCCTGG + Intergenic
1147592876 17:41696312-41696334 GAGGGGGCAACAAGGGTGCATGG - Intergenic
1148255477 17:46127630-46127652 GAGTGTGCCACCACCATGCCTGG - Intronic
1149485518 17:57039756-57039778 GAGTGTGTCAGAGGGATCCAGGG - Intergenic
1150252306 17:63713371-63713393 GAGTGTGTCACATGGAGGGAGGG - Intronic
1151031093 17:70740092-70740114 GGGTGTGCGATAAGGATGTATGG + Intergenic
1151828340 17:76535928-76535950 GAGTGTGCCAGACGCATGCAAGG + Intronic
1156356706 18:36348555-36348577 GAGTGTGCTCCATGGATCCATGG - Intronic
1158118107 18:54019128-54019150 GAGGGAGCCACAGGGCTGCAGGG - Intergenic
1158359844 18:56659634-56659656 GAGTGTGCCAGAAGGAATCTGGG + Intronic
1158532950 18:58279981-58280003 GAGTGTGCTTCAGGGATGGAAGG - Intronic
1158806824 18:60983650-60983672 CTGTGTGCAACAAGGAAGCATGG + Intergenic
1162700905 19:12513886-12513908 GGGTGTGCCGCCAGGATGCCTGG - Intronic
1162770182 19:12944607-12944629 GAGTGTTCCACAAGATTCCAGGG + Intergenic
1164749084 19:30637989-30638011 GAGTAAGCCACAAGGATGTTTGG - Intronic
1166158478 19:40933763-40933785 GAAGGTGCCAGAAGGAGGCAGGG + Intergenic
1166201574 19:41240850-41240872 GAGTGTGCAGTAAGCATGCAAGG - Intronic
926082469 2:9999139-9999161 GAGGGTGTCACTAGCATGCACGG - Intronic
927316262 2:21686650-21686672 GAGAGTTCTTCAAGGATGCAAGG + Intergenic
928389090 2:30895374-30895396 AAGTGTTCCACAAGGACACAAGG + Intergenic
928873553 2:36010877-36010899 GAGAGTGGGACAATGATGCAAGG - Intergenic
929545114 2:42850629-42850651 GAGTTTGCCACATGGATGTAAGG + Intergenic
931899549 2:66772422-66772444 GAGAGTTCCACAAGGAGGAAAGG + Intergenic
932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG + Intronic
933460208 2:82573627-82573649 GACTGTGCCAAAAGGACCCATGG + Intergenic
935197352 2:100825502-100825524 GGGTAGGCCACAAGGATGAAGGG - Intronic
937468955 2:122158814-122158836 AAATGAGCCAAAAGGATGCAAGG - Intergenic
937620056 2:123975056-123975078 AAGTTTGCCACAAAGATGGAAGG - Intergenic
940287882 2:152050244-152050266 CAGTGTGCCAAAAGGATGGAAGG - Intronic
946890631 2:224272372-224272394 GAGGGTGCCACAAAGTAGCAGGG + Intergenic
948509004 2:238450704-238450726 GAGTGTGTCCCATGGATCCAGGG - Exonic
948648946 2:239426853-239426875 GAGGGTGACAGAAGGATGGAAGG - Intergenic
1169600254 20:7251028-7251050 CAGAGTGCCTCAAGGATTCAAGG + Intergenic
1174141444 20:48417061-48417083 AAGTGGGGTACAAGGATGCAGGG + Intergenic
1175565896 20:59976805-59976827 GAATGAGCCACAAGTCTGCAGGG + Intronic
1177705957 21:24705218-24705240 GAGGATGCCACATGCATGCAGGG + Intergenic
1180017191 21:45095175-45095197 GACTGAGCCAGAAGGATGCCAGG - Intronic
1180065494 21:45410189-45410211 GAAAGTGCCAGAAAGATGCAGGG - Intronic
1183550446 22:38480017-38480039 GACTGTGCTACAGGGATACAGGG - Intronic
1183935785 22:41261399-41261421 GAGTGCACCTCAAGGCTGCAGGG + Intronic
1185232922 22:49693689-49693711 CCGTGTGCAACAAGGCTGCAGGG + Intergenic
949535172 3:4989676-4989698 GAGGGTGTCACAAGGCTGCTGGG + Intergenic
951255694 3:20446983-20447005 GTGTGTGCAACATGGAAGCATGG + Intergenic
954695612 3:52423399-52423421 GACTGTGAGACAAGGAAGCAGGG + Exonic
955541428 3:59980644-59980666 GCTTGTCCCACAAGGAGGCAAGG + Intronic
958260489 3:91374839-91374861 TAGTATGCCCCAAGGATGAATGG - Intergenic
960998159 3:123352927-123352949 GAAGGTGCCACAAGGGTGCTGGG + Intronic
961582029 3:127891184-127891206 GAGGCTGCCACAAGGGGGCAGGG - Intergenic
961765276 3:129205637-129205659 GACTGTGACCCAAGGATGCGTGG - Intergenic
962985030 3:140528339-140528361 GAGTGTGCAATAAGGCTGCAAGG - Intronic
966339772 3:178912723-178912745 GTGTGTGCCAGAAAGATCCATGG - Intergenic
970616255 4:17770961-17770983 GAGTGTGACTCACAGATGCAAGG - Intronic
971419482 4:26462376-26462398 GGGTGTGCCACAGGTAGGCAGGG - Intergenic
973792932 4:54394983-54395005 GAGTGTGCAACAAAGATGGGTGG - Intergenic
974077273 4:57178718-57178740 GACTGTGCCAGAGGGATGCTAGG + Intergenic
976319831 4:83701256-83701278 GAGTTTACCACAGGAATGCAAGG - Intergenic
977785868 4:101034258-101034280 GAGTGAGCCACACAGATGCCAGG - Intronic
978272303 4:106905601-106905623 GAGTGAGCCACATGGATGATTGG - Intergenic
978546006 4:109873341-109873363 GAGTGTGCCAAAGGGAGCCAAGG - Intergenic
979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG + Intronic
982522238 4:156432713-156432735 GAGTGTGCCACCTGGACCCAAGG + Intergenic
985333820 4:188870291-188870313 AAGTGCCTCACAAGGATGCAGGG + Intergenic
986165856 5:5271031-5271053 GAGGGTTCCACAAGGATTGAGGG + Intronic
992822241 5:80509117-80509139 GCGTGTGCCACCAGCATGCCTGG + Intronic
994187570 5:96832081-96832103 GAGTGTGCCAGAACCATGCAGGG + Intronic
997084011 5:130775075-130775097 GTGGGTGCCACATGGAGGCAGGG - Intergenic
998166204 5:139845696-139845718 CTGTGTGATACAAGGATGCAAGG + Intergenic
998969896 5:147579658-147579680 GAGTGTGCCACCACCATGCCCGG - Intergenic
999742906 5:154570200-154570222 GAGTATCAAACAAGGATGCATGG - Intergenic
1002298150 5:178242498-178242520 GCGTGTGCCACGAATATGCAGGG - Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1003520881 6:6857301-6857323 GAGTATGCCTCAAGGAAGCCAGG - Intergenic
1007840304 6:44710787-44710809 GAGTGTCTAACTAGGATGCATGG - Intergenic
1007840321 6:44710937-44710959 GAGTGTCTAACTAGGATGCATGG - Intergenic
1007840400 6:44711567-44711589 GAGTGTCTAACTAGGATGCATGG - Intergenic
1007840432 6:44711803-44711825 GAGTGTCTAACTAGGATGCATGG - Intergenic
1008429329 6:51397120-51397142 GAGAGTGTTATAAGGATGCATGG - Intergenic
1008994728 6:57645533-57645555 TAGTATGCCCCAAGGATGAATGG + Intronic
1009183272 6:60544330-60544352 TAGTATGCCCCAAGGATGAATGG + Intergenic
1010160154 6:72844300-72844322 GAGAGTGCTACAAAGATGCAAGG + Intronic
1011113866 6:83868136-83868158 AACTGTGCCACAGGGAAGCATGG + Intronic
1011208675 6:84930350-84930372 CAGTGTGTCAAAAGGGTGCACGG + Intergenic
1012592943 6:101005319-101005341 CAGTGTGGCACCAGAATGCAGGG + Intergenic
1014761313 6:125359835-125359857 GTGTGTACCATAAGGAAGCAAGG - Intergenic
1016622152 6:146123415-146123437 GAGTTTGCCTGATGGATGCAGGG + Intronic
1016839622 6:148513374-148513396 GAGTGTGCAACACGGGTGCGTGG - Intronic
1018301031 6:162403320-162403342 GAGTGAGGCACAGGGCTGCATGG - Intronic
1023153722 7:37226694-37226716 GGATGTGCCTTAAGGATGCATGG + Intronic
1028419214 7:90613302-90613324 CAGCCTGCCACCAGGATGCAGGG - Intronic
1031230492 7:119099813-119099835 GTGTGTGAGACAAGGAGGCAAGG + Intergenic
1034398556 7:150846388-150846410 GAGTGGGCCACAAGGATGCCTGG - Intronic
1039880516 8:41622514-41622536 GACTGTGCCACGAGGGAGCATGG - Exonic
1040298833 8:46177468-46177490 GGGTGTGCCACAGGGACTCAGGG + Intergenic
1040330140 8:46381674-46381696 GGGTGGGCCACAAGGACTCAGGG + Intergenic
1041847908 8:62352813-62352835 GGGTGTTCCACAAAGATGAATGG - Intronic
1044824575 8:96183910-96183932 GAGTGAGGGACAAGGCTGCAGGG - Intergenic
1049095328 8:140545126-140545148 GAGTGAGTCACAGGCATGCAGGG - Intronic
1051569540 9:18540395-18540417 GAGAGTGACACAGGGATGGAGGG + Intronic
1054750227 9:68898030-68898052 GGGGCTGCCACAAGGATGCCAGG - Intronic
1059745431 9:117195826-117195848 GAGTGGTCCCCAAGGGTGCAGGG - Intronic
1060600419 9:124873713-124873735 GAGAGTTCCGCAAGGCTGCATGG - Exonic
1060654416 9:125359212-125359234 GAGTGAGCCAAGGGGATGCAGGG - Intronic
1061466492 9:130784730-130784752 GAATGTACCAAAAGGAAGCAAGG - Intronic
1186393988 X:9189412-9189434 GTGTGTGAAAAAAGGATGCACGG - Intergenic
1188034415 X:25300902-25300924 GAGGGAGACACAAGCATGCAAGG + Intergenic
1192249428 X:69399076-69399098 GAGTGCTCCACCAGAATGCAGGG + Intergenic
1193978267 X:88150253-88150275 GAGTGAGCCTCAAGGTTTCATGG + Intergenic
1195920224 X:109976303-109976325 AAGTTAGCCACAAGGCTGCATGG - Intergenic
1200080297 X:153572877-153572899 GCGTCTGCCACTAGGAGGCACGG + Intronic