ID: 979213391

View in Genome Browser
Species Human (GRCh38)
Location 4:118133372-118133394
Sequence AGGGAGAGCACAGTGACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 17, 2: 34, 3: 114, 4: 489}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979213391_979213406 21 Left 979213391 4:118133372-118133394 CCCCCTGTCACTGTGCTCTCCCT 0: 1
1: 17
2: 34
3: 114
4: 489
Right 979213406 4:118133416-118133438 CGCACTTCATGGCCACTGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 120
979213391_979213401 10 Left 979213391 4:118133372-118133394 CCCCCTGTCACTGTGCTCTCCCT 0: 1
1: 17
2: 34
3: 114
4: 489
Right 979213401 4:118133405-118133427 AATAGACCCTCCGCACTTCATGG 0: 1
1: 0
2: 0
3: 2
4: 43
979213391_979213407 28 Left 979213391 4:118133372-118133394 CCCCCTGTCACTGTGCTCTCCCT 0: 1
1: 17
2: 34
3: 114
4: 489
Right 979213407 4:118133423-118133445 CATGGCCACTGCCGGGAGATAGG 0: 1
1: 3
2: 11
3: 49
4: 211
979213391_979213405 20 Left 979213391 4:118133372-118133394 CCCCCTGTCACTGTGCTCTCCCT 0: 1
1: 17
2: 34
3: 114
4: 489
Right 979213405 4:118133415-118133437 CCGCACTTCATGGCCACTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 87
979213391_979213409 30 Left 979213391 4:118133372-118133394 CCCCCTGTCACTGTGCTCTCCCT 0: 1
1: 17
2: 34
3: 114
4: 489
Right 979213409 4:118133425-118133447 TGGCCACTGCCGGGAGATAGGGG No data
979213391_979213408 29 Left 979213391 4:118133372-118133394 CCCCCTGTCACTGTGCTCTCCCT 0: 1
1: 17
2: 34
3: 114
4: 489
Right 979213408 4:118133424-118133446 ATGGCCACTGCCGGGAGATAGGG 0: 1
1: 1
2: 6
3: 30
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979213391 Original CRISPR AGGGAGAGCACAGTGACAGG GGG (reversed) Intronic
900103928 1:974213-974235 AGGGAGAGCAGGGGGACATGGGG + Intronic
900496576 1:2978596-2978618 AAGGAGGGCACACGGACAGGAGG + Intergenic
900707699 1:4090683-4090705 AGGGAGAAGGCAGTGTCAGGAGG + Intergenic
901143159 1:7048641-7048663 AGGGAAGGCTCAGGGACAGGTGG - Intronic
901150979 1:7101057-7101079 AGTGTGGGCACAGTGCCAGGGGG - Intronic
901638536 1:10681531-10681553 AGGGAGAGGACAGTCCCGGGAGG - Intronic
902197603 1:14809371-14809393 AGGAAGAGCAAAGTCACAGAGGG - Intronic
903292910 1:22326026-22326048 AGGGAGATGAGCGTGACAGGGGG - Intergenic
903478775 1:23638203-23638225 AGGGAGAGGAGAGAGAGAGGAGG + Intronic
904277735 1:29395145-29395167 TGGGAGAGGACAAGGACAGGCGG + Intergenic
904459492 1:30667734-30667756 AGGCAGAGCACACTGGCAGGCGG - Intergenic
904490820 1:30858051-30858073 AGGGAGGGGACAGGGGCAGGGGG - Intergenic
904647330 1:31977744-31977766 AGGGACAGCACAGTGGCCCGGGG + Intergenic
905106900 1:35568929-35568951 AGGGAGAGCACCCTGACAGCAGG - Intergenic
905234396 1:36535960-36535982 AGGTGGAGCACAGAGGCAGGTGG + Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905969559 1:42131268-42131290 AGAGAGGCCACAGAGACAGGAGG + Intergenic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906935213 1:50208665-50208687 AGGGAGAGCACAGGAATAAGAGG + Intergenic
907044186 1:51289690-51289712 AGGGAGGGCAATGTGACAGATGG - Intronic
907525644 1:55052524-55052546 AGGGAGGGGACAGTGACAGCTGG - Intronic
907975179 1:59424663-59424685 AGGGAGCTCACAGTGCAAGGTGG - Intronic
908567054 1:65368193-65368215 AGGGAGACACCAGTGACAGCTGG + Intronic
909111457 1:71483395-71483417 AGGGCAAGCACAGTAACATGGGG + Intronic
909512607 1:76471785-76471807 AGGAAGAGCAAAATGACAAGAGG - Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911024551 1:93423204-93423226 ATGGAGAGCAAAGTAAAAGGGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912682816 1:111739680-111739702 AGGGAGAGCACAGTTTTACGGGG + Intronic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
913277453 1:117153087-117153109 GGGGATATCAAAGTGACAGGTGG - Exonic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
916464713 1:165062396-165062418 AGGGAGATCACGGGGAAAGGGGG + Intergenic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918399285 1:184147383-184147405 TGGGTGAGCACAGGGCCAGGTGG + Intergenic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919252847 1:195081697-195081719 AGAGAGAGCAAAGTGGGAGGTGG + Intergenic
919257592 1:195143401-195143423 GGGGAGAGCACAGGGACCGGAGG - Intergenic
919793659 1:201308358-201308380 AGCAAGAGCTCAGTGAAAGGTGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920655032 1:207868621-207868643 GGGGAGAACGCAGAGACAGGTGG - Intergenic
920691099 1:208146817-208146839 AGGGAGGTGACAGGGACAGGTGG + Intronic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921449851 1:215292324-215292346 AGTGAGAGGATAGTGACAGGTGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922831390 1:228556294-228556316 AGGGAGAGCAGAGTCAGAGAAGG - Intergenic
922858358 1:228794525-228794547 GGGGAGATCACAGTGAAAGAAGG - Intergenic
923660162 1:235950648-235950670 AAGGAGAGCTGAGTGGCAGGAGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1062821315 10:536485-536507 AGGGACATCACAGTCCCAGGGGG + Intronic
1062929790 10:1345171-1345193 GGGGGGACCACCGTGACAGGTGG - Intronic
1064598819 10:16972837-16972859 ATGGAGAGCGCAGGGACACGTGG - Intronic
1065128531 10:22597469-22597491 AGGCAGAAACCAGTGACAGGAGG - Intronic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067450174 10:46377176-46377198 AGGGAGAGCCCAGTGCTGGGTGG + Intronic
1067587068 10:47482587-47482609 AGGGAGAGCCCAGTGCTGGGTGG - Intronic
1067634128 10:47990354-47990376 AGGGAGAGCCCAGTGCTGGGTGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068556038 10:58460089-58460111 AAGGAGAGCACAGAGACAGAAGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069631012 10:69897074-69897096 GGGAAGAGCACAGTGACAGAAGG + Intronic
1069784530 10:70979204-70979226 GGGAAGTGCACAGTGGCAGGAGG - Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070646291 10:78204456-78204478 AAGGAGAGCCCAGTGGGAGGAGG + Intergenic
1070733814 10:78849986-78850008 AGGGAGAGCATTCTGAGAGGAGG - Intergenic
1070835745 10:79445813-79445835 AGGGCGAGGACAGTGCCAGGCGG - Intergenic
1072219567 10:93316208-93316230 CTGGAGAGCACAGTGCCATGGGG + Intronic
1073006832 10:100330835-100330857 GGGGAAAGGACAGTGGCAGGAGG + Intergenic
1073126202 10:101151443-101151465 AAGGGAAGCTCAGTGACAGGGGG + Intergenic
1073263351 10:102207401-102207423 AGTGAGAGGAAAGTGACAGCAGG + Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075065608 10:119287192-119287214 AGGGAGAGAACAGGGAGAGAGGG + Intronic
1075265504 10:120997215-120997237 AGGAAGACCACAGTGTCAGGGGG - Intergenic
1076067905 10:127463739-127463761 AGGGAGGGCACAGGGACAGCAGG - Intergenic
1076261733 10:129071842-129071864 AGTGGGAGCACAGGCACAGGAGG + Intergenic
1076864127 10:133159119-133159141 AGAGAGAGCTCAGGGACAGCTGG + Intergenic
1076875953 10:133215617-133215639 AGGATGAGCACAAGGACAGGTGG + Intronic
1077466693 11:2736862-2736884 AGGGACCCCACAGTCACAGGTGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079053634 11:17186037-17186059 AAGCAGTGCACAGTTACAGGAGG - Intronic
1079150438 11:17894222-17894244 AGTGAGAGCACAGTGTAAGTTGG - Intronic
1079315525 11:19404948-19404970 ACAGAGAGCACAGAGAGAGGAGG - Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079892876 11:26079946-26079968 AGGGAGAGGAGAGGGAGAGGGGG + Intergenic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1080938394 11:36886064-36886086 AGGGAGAGTCCAGTGGCAGCAGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081578271 11:44333322-44333344 AGTGAGAGCACATGGACACGGGG - Intergenic
1081825738 11:46049612-46049634 AAGGAGAGTGCTGTGACAGGTGG - Intronic
1082783030 11:57301671-57301693 ATGGAGAGGAGAGTGAGAGGAGG + Intronic
1083169329 11:60913587-60913609 AGGCAGTGCATAGGGACAGGAGG - Intergenic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1083733377 11:64665717-64665739 AGGCCCAGCTCAGTGACAGGCGG + Intronic
1084169851 11:67395847-67395869 TGGGACAGCAGAGTGGCAGGTGG + Intronic
1084747783 11:71184160-71184182 AAAAAGAGCATAGTGACAGGTGG - Intronic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086124440 11:83335623-83335645 AGGGAGAGCCCTTGGACAGGAGG - Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1087029126 11:93684715-93684737 AGGGAGAGTCCAGTGGCAGCAGG - Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089456893 11:118631100-118631122 AGGGAGAGCAGGGTTACAGGGGG - Intronic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1091187624 11:133660375-133660397 AGGGAAACTACAGGGACAGGTGG + Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094083769 12:26566188-26566210 AGGGAGATGAGAGTGAGAGGAGG + Intronic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095049887 12:37545943-37545965 GGTGACAGCACAGTGGCAGGGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096611629 12:52805805-52805827 GGGGAGAGGACAGTCAGAGGTGG - Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101814775 12:108137483-108137505 AGAGAGTGCACAGTGACAGCAGG + Intronic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1104057107 12:125239036-125239058 AGGGAGAGCATGGTGAGGGGCGG + Intronic
1104619233 12:130298370-130298392 AGGGAGTAGAAAGTGACAGGGGG - Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106793710 13:33183017-33183039 AGGGAGAGGAATGTGACAGATGG - Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107721938 13:43258437-43258459 AGGGAGAGCAGGGTTAGAGGTGG + Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1109330464 13:60922900-60922922 AGATAGAGCCCAGTGCCAGGTGG - Intergenic
1109718681 13:66249418-66249440 AGTAAGGGAACAGTGACAGGTGG + Intergenic
1109914358 13:68961477-68961499 AGCAATAGCACAGTGATAGGAGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110542274 13:76719959-76719981 AGGGATAGTACAGTGGCAGCAGG + Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111685802 13:91499368-91499390 AGGGAGAGAAAAGTGAGAGATGG + Intronic
1111868937 13:93805991-93806013 AAGGAGAGCACAGTGACCTAAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1114657801 14:24326347-24326369 TGGGAGAGCACAGGGGGAGGTGG + Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115680824 14:35736031-35736053 GGCCAGAGCAGAGTGACAGGTGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1116969675 14:51051254-51051276 AGGAAGAGAACAGTGAGAGAGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118402628 14:65393923-65393945 AGTGAGAGCCAAGTGAAAGGGGG + Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118672412 14:68143702-68143724 AGGCAGAGTATAGTGACAGCTGG - Intronic
1120143120 14:80950693-80950715 AGGGAGAGGAAAGTGATAAGGGG + Intronic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121248610 14:92483125-92483147 AGGCAGAGCAATATGACAGGTGG + Intronic
1121472499 14:94166166-94166188 AGGGAGAGGGCAGTGAGATGGGG - Intronic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1121719828 14:96101462-96101484 AGGGGGAGGACAGAGCCAGGTGG - Intergenic
1122301069 14:100731461-100731483 AGAGAGACCACAGGGACACGTGG + Intronic
1122597401 14:102902942-102902964 CAGGAAAGCAAAGTGACAGGTGG - Intronic
1124065606 15:26340925-26340947 AGGAGAAGCACAGTGGCAGGAGG + Intergenic
1125193421 15:37019662-37019684 AGGGAGAGCATAGTGTGGGGAGG + Intronic
1125743437 15:41983377-41983399 AGGTAGAGGACAGAGAGAGGAGG + Exonic
1126612862 15:50547311-50547333 AGGAAGCACACAGGGACAGGAGG + Intergenic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1127628136 15:60800550-60800572 TGGGACAGCACTGTGAGAGGAGG + Intronic
1129264731 15:74387549-74387571 AGAGAGAGCACATGGACCGGCGG + Intergenic
1129721147 15:77878812-77878834 AGGGAGGGAAAAGGGACAGGAGG + Intergenic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130317422 15:82808766-82808788 TGGGAGTGCACTGAGACAGGTGG - Intergenic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130624280 15:85497468-85497490 GGGAAGAGCAGAGTGAGAGGAGG + Intronic
1131233040 15:90673487-90673509 AAGGAGAGCGGAGAGACAGGTGG + Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132424456 15:101702930-101702952 AGTGAGAGCACACAGAAAGGAGG + Intronic
1132499669 16:279916-279938 AGGGAGAGGACACTGACAAGGGG - Intronic
1132950569 16:2560012-2560034 GGGGAAAGGACAGTGATAGGAGG + Intronic
1132963780 16:2640158-2640180 GGGGAAAGGACAGTGATAGGAGG - Intergenic
1134090677 16:11390209-11390231 AGGGAGGGGACAGTGAGAGCTGG + Intronic
1134091433 16:11393598-11393620 GGGGAGAGACCAGGGACAGGTGG - Intronic
1135388862 16:22071221-22071243 AGGGAGAGCCCCGTGAGAGGAGG + Intronic
1135480011 16:22814433-22814455 AGGGTGCGCACAGTGCCAGGGGG - Exonic
1135723392 16:24835765-24835787 AATGAGAACACAGTGAAAGGGGG + Intergenic
1136111713 16:28067638-28067660 AGGGACAGCATGGAGACAGGAGG - Intergenic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136605196 16:31329201-31329223 AGGGAGAAAAAAGGGACAGGAGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137383896 16:48023813-48023835 AGAGAGAGCAGAGAGAGAGGTGG + Intergenic
1137490360 16:48927339-48927361 AAGGAGGGAACAGTTACAGGAGG + Intergenic
1137630930 16:49944213-49944235 AGGGAGAGAACAGGGCCACGTGG + Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140017412 16:71200923-71200945 AGGGAGAGCCCAGACAGAGGAGG - Intronic
1140109405 16:71990289-71990311 AGGAAGAGGATAGTGACATGTGG + Exonic
1140201221 16:72896364-72896386 AGGGAAGGCACAGAGACAGATGG - Intronic
1140461803 16:75146018-75146040 AGGGGGAGCACAGAGGCAAGTGG - Intergenic
1140474851 16:75234758-75234780 AGGGAGGTCAAAGTGAGAGGAGG + Intronic
1141398217 16:83723603-83723625 AGGGAGTGACCAGTGACAGGTGG - Intronic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1143162795 17:4882201-4882223 GAGCAGAGCACAGTGAGAGGAGG - Intronic
1143374319 17:6458340-6458362 AAGAAGATGACAGTGACAGGAGG - Intronic
1144065839 17:11623344-11623366 AAGGAGAACAAAGTGAAAGGGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146756177 17:35433629-35433651 AAGGAAAGCAAAGTGGCAGGAGG - Intergenic
1147131210 17:38410403-38410425 AGGGAAGGCAGAGTGGCAGGAGG - Intergenic
1148346683 17:46908158-46908180 AGGGGGGACACAGAGACAGGAGG - Intergenic
1148441327 17:47713161-47713183 AATGAGAGCACAGAGGCAGGGGG + Intergenic
1148530625 17:48387329-48387351 AGAGAGTGCACAGGGATAGGAGG - Intronic
1148736592 17:49868598-49868620 AGGGAGAGGAGAGACACAGGAGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150321324 17:64216860-64216882 AGGGAGAGCTGGGTGTCAGGTGG + Intronic
1150535683 17:66037360-66037382 AGGGAGAGGAGAGAGAGAGGTGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150576403 17:66434475-66434497 AGGGAGAGGTCAGAAACAGGAGG + Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1152644281 17:81461599-81461621 AGGAAGAGGACACGGACAGGCGG - Exonic
1152753336 17:82076677-82076699 AGGCCGGGCACAGTGAGAGGTGG - Intergenic
1152829021 17:82486037-82486059 TGGGAGAGAGCAGTGAGAGGTGG + Intronic
1152883066 17:82831427-82831449 CGGGTGAGGCCAGTGACAGGTGG + Exonic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154403276 18:14063394-14063416 AGAGAAAGCACAGTGAAAAGGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156783048 18:40875400-40875422 CGGGAAAGCACAGTGGCATGTGG - Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1157324183 18:46657257-46657279 TGGGAGGGGACAGGGACAGGAGG - Intergenic
1157414418 18:47490051-47490073 GGGCAGAGCACAATGAGAGGTGG + Intergenic
1158439843 18:57465996-57466018 AGGGTGAGCACAGGTACAAGAGG - Intronic
1158506510 18:58050797-58050819 AGGGTGAGGACAGTGACAAATGG + Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1161032108 19:2062266-2062288 AGTGAAAGCACAGAGGCAGGTGG + Intergenic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1162585486 19:11555664-11555686 AGGGAGAGAGGAGGGACAGGTGG + Intronic
1163408935 19:17141406-17141428 GGGGAGGGCACAGGGGCAGGGGG - Intronic
1163982787 19:20916964-20916986 AGTTAGAGCACATTGCCAGGAGG + Intergenic
1164524572 19:29003931-29003953 TGGGGGAGCACAGAGAAAGGGGG - Intergenic
1165363981 19:35352632-35352654 AGCCAGAGCACGGTGGCAGGGGG + Exonic
1166299754 19:41907005-41907027 AGGGAGAGCAGAGAGAGAAGGGG - Intronic
1166348548 19:42182362-42182384 AGGAAGAGAACAAGGACAGGAGG + Intronic
1167246349 19:48375578-48375600 AGGGAGAGAAAAGGGGCAGGGGG - Intronic
1167430353 19:49450721-49450743 AGGGAGAGGACAGAGAGAGGAGG - Intronic
1168536917 19:57178578-57178600 AGGGAGAGGGCAGTCACACGAGG - Intergenic
1168536923 19:57178609-57178631 AGGGAGAGGGCAGTCACACGAGG - Intergenic
926075007 2:9935443-9935465 AGGGAGAGCAGATGGGCAGGTGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927496234 2:23553698-23553720 AGGCTGAGAAGAGTGACAGGTGG - Intronic
928251813 2:29687331-29687353 AGGGACAGCACATTGGCAGCTGG - Intronic
928287891 2:30009132-30009154 AAGAAGAGCAGAGTGCCAGGAGG - Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
931129511 2:59318420-59318442 AGAGAGAGAACAGAGACAGAAGG + Intergenic
931417953 2:62099156-62099178 AGAGAGAGCAGAGGGTCAGGAGG + Intronic
931880210 2:66560824-66560846 AGGTAGAGAACAGCGGCAGGAGG - Intronic
932627508 2:73309285-73309307 ACTGAGAGCACAGTGACAAGGGG - Intergenic
932804011 2:74767599-74767621 AGGGTGTGCAAAGAGACAGGGGG - Intergenic
933605011 2:84373571-84373593 GGAGAGTACACAGTGACAGGAGG - Intergenic
935347417 2:102121384-102121406 AGGCAGTGCTCAGTGACACGTGG - Intronic
935707567 2:105870177-105870199 AGTGAGACCACAGTGCCACGGGG + Intronic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937952985 2:127402453-127402475 TGGCAGAGCACTGTGCCAGGAGG + Intergenic
939198210 2:138999874-138999896 AAGATGAGAACAGTGACAGGAGG + Intergenic
939727319 2:145738379-145738401 AGAGAGAGCATTGTAACAGGAGG + Intergenic
939967704 2:148626627-148626649 AGGGATGGAACAGTGGCAGGGGG + Intergenic
940639566 2:156332607-156332629 AGGGAGGGAGCAGGGACAGGCGG + Exonic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941995435 2:171597293-171597315 AATGAGAGGCCAGTGACAGGAGG + Intergenic
942632997 2:177972279-177972301 AGGAAGAGAACAGTGACAGAAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
943944548 2:194043088-194043110 AGGCAGAGGCCATTGACAGGGGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944543032 2:200771960-200771982 AGGGAGAGATCAGACACAGGGGG + Intergenic
945179524 2:207077528-207077550 AGGGAAAGCACACAGAGAGGAGG + Exonic
945923226 2:215777721-215777743 AGGGAGAACACAGTGTGAAGGGG - Intergenic
946746786 2:222854317-222854339 AGAGTGAGCAAAGAGACAGGAGG + Intergenic
946996531 2:225398649-225398671 AGGGAGAGCATTGGGATAGGGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948236127 2:236391992-236392014 AGGGAGCGCCCAGTGAAAGCAGG - Exonic
948520831 2:238536460-238536482 GGGGTGAACACTGTGACAGGAGG - Intergenic
948521204 2:238539297-238539319 GGTGTGAGCACAGTAACAGGAGG - Intergenic
948522589 2:238549815-238549837 AGTGTGAGCACTGTGCCAGGAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
949030836 2:241796621-241796643 AGGGAGAGAACAGTGGGATGTGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169132052 20:3171324-3171346 AGGTAGAGCACGGAGAAAGGAGG - Intronic
1169459957 20:5785941-5785963 AAGGAGAGCACAGTGAAGAGTGG - Intronic
1169927193 20:10795396-10795418 GGGGAAAGCAAAGTGAAAGGAGG - Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170357772 20:15510790-15510812 ACGGTGAGCCCAGTGACAGAAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171147980 20:22802493-22802515 AAGGAAAGGACAGTGGCAGGAGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172578736 20:36030277-36030299 AGGGAGGGGAGAGTGGCAGGAGG + Intronic
1173001835 20:39110501-39110523 AGGGAGAGCACAGGGGAAGCAGG - Intergenic
1176049798 20:63112742-63112764 AGGGAGAGAACTGAGACACGTGG + Intergenic
1177565904 21:22819330-22819352 AGGGAGAGCCCAGGCAGAGGAGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1178089231 21:29143786-29143808 ATGGGGAGCACAGTGGGAGGGGG + Intronic
1179643422 21:42761359-42761381 AGGGACTGCAGAGGGACAGGAGG + Intronic
1180152573 21:45958389-45958411 TGGGAGAGCACAGAGTCAGCAGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180622033 22:17168789-17168811 AGGGAGCTCACAATGACAAGAGG - Intergenic
1181603355 22:23965290-23965312 GGGGAGAGGGCAGGGACAGGTGG - Intergenic
1181605159 22:23976017-23976039 GGGGAGAGGGCAGGGACAGGTGG + Intronic
1181941068 22:26477565-26477587 TGTCAGAGCACAGTCACAGGAGG + Intronic
1184048190 22:41985299-41985321 AGAGAGGGCACTGTGAGAGGAGG - Intronic
1185005869 22:48276690-48276712 GGGGAGGGCACTGTGGCAGGTGG + Intergenic
1185239593 22:49735432-49735454 GGGGAGGGGACAGTGGCAGGAGG + Intergenic
949508166 3:4745796-4745818 AGGGAGATGACAGTGTCATGGGG - Intronic
949876071 3:8626802-8626824 AAGGAAAGCAGAGTGAGAGGTGG + Intronic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950171267 3:10840418-10840440 AGGGTGGGCACAGAGAAAGGTGG - Intronic
950185320 3:10941431-10941453 AGGCAGAGCACAGAGAGATGAGG + Intergenic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952687573 3:36167746-36167768 AGGGAGAAGAGAGTGAGAGGAGG - Intergenic
952742528 3:36748410-36748432 AGGCACAGCAGAGTGAGAGGAGG + Intergenic
954411833 3:50374289-50374311 GGGGAGAGGAGAGGGACAGGAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954570698 3:51638410-51638432 AGGGAGAATAAAGTGAGAGGGGG + Intronic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
962168455 3:133075868-133075890 AGGGTGAGGACAAAGACAGGAGG + Intronic
962273490 3:133995356-133995378 GTGGGGAGCTCAGTGACAGGGGG - Intronic
962587001 3:136851798-136851820 AGGAAGAGCAATGTGACAGTGGG + Intronic
962715303 3:138120503-138120525 AAGGGGAGCAGAGTGACAGAAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963393435 3:144699793-144699815 AAGGAGAGCACAGTCAAGGGAGG - Intergenic
963509632 3:146230685-146230707 AGGGAAAGGAGAGGGACAGGAGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963728262 3:148946048-148946070 AGGGGGTGGAGAGTGACAGGTGG - Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
967608831 3:191481054-191481076 AGGAAGAGCACAGTGATAAAGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
968881924 4:3305345-3305367 AGCAGGTGCACAGTGACAGGTGG - Intronic
970026520 4:11629855-11629877 AGGGAGAACACAGAGAAGGGCGG + Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
971394939 4:26218819-26218841 AGGGAGGGCACAGAGCCACGTGG + Intronic
971946650 4:33287270-33287292 AGGGAGGGCTCAGTGTGAGGTGG - Intergenic
971946658 4:33287311-33287333 AGGGAGGGCTCAGTGTGAGGTGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972551961 4:40142114-40142136 AGGGAGACCATAGGGAGAGGGGG + Intronic
972557956 4:40199371-40199393 AGGGAAAGTAGGGTGACAGGTGG + Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976318566 4:83685741-83685763 AGGGAGAGGACAGGGCCAAGAGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977707191 4:100085311-100085333 GGGGTGAGCACAGTGAGATGAGG + Intergenic
977861303 4:101963801-101963823 ATGGAGTGCACAGATACAGGAGG - Intronic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979457184 4:120940518-120940540 AGTCAGAGCACAGTTACATGAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981282297 4:142972224-142972246 AAGGAGGGCAGAGTGAAAGGAGG + Intergenic
982644378 4:158005011-158005033 AGGCAGAGCAATGTGTCAGGCGG + Intergenic
982719872 4:158848392-158848414 AAGGGGAGCACAGTGTCAGCTGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
984260728 4:177441666-177441688 AGTTAGATCACAGTCACAGGAGG + Intronic
984351417 4:178599887-178599909 AAGGAAAGCACAGTTAGAGGAGG + Intergenic
984634236 4:182093533-182093555 AGGCAGAGTGCAGAGACAGGTGG + Intergenic
985097115 4:186423922-186423944 AGGGAGAGAGCAGTCATAGGTGG - Intergenic
985485383 5:145760-145782 GGGGAGAGACCAGGGACAGGGGG + Intronic
985529394 5:424919-424941 AGGGGGACCACAGTGCCTGGAGG - Intronic
985812438 5:2099611-2099633 AGGCCCAGCCCAGTGACAGGGGG + Intergenic
986323909 5:6657433-6657455 TGGGAGAGCACAGTGTAAGCTGG + Intronic
986447265 5:7832286-7832308 AGGAAGAGCACAGGGACAAACGG - Intronic
987068372 5:14311423-14311445 AGGGAGAACACAGAGAAAGCTGG - Intronic
987266984 5:16266080-16266102 AGGGAGAGCAGATGGAGAGGGGG - Intergenic
987595876 5:19998420-19998442 AGGGAGGGCACTGTCAGAGGAGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991199762 5:63978451-63978473 AGGCAGATCAAAGTGACAGAAGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992384169 5:76267830-76267852 AGGGACATCACATTGACAGTGGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996192902 5:120567368-120567390 AGGTAAAGCACAGTGGCAGGAGG - Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
997250758 5:132386943-132386965 AGGTAGAGCACAGCCATAGGTGG - Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998785391 5:145703346-145703368 AGGGAGAGCTAAGAGACAGAAGG - Intronic
999099223 5:149008847-149008869 AGGCTCAGCACAGTCACAGGTGG - Exonic
999268052 5:150279771-150279793 GGAGAGGGCACAGTGACAGTGGG + Intronic
999933480 5:156459143-156459165 AGGGAGAAGACAAAGACAGGAGG - Intronic
1000285736 5:159824767-159824789 AGGGAGAGAAAAGTGAGAGCAGG - Intergenic
1000347613 5:160327991-160328013 ATTGAGAGCTGAGTGACAGGAGG + Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001311413 5:170613584-170613606 GGGGAGACCACAGGGAAAGGAGG + Intronic
1001743483 5:174072170-174072192 AGGGAGAGGGCTGGGACAGGTGG - Intronic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1002770182 6:283635-283657 GGGGTGGGCACAGTGAAAGGTGG + Intergenic
1004168739 6:13279050-13279072 AGGGAAAGAATAGTGTCAGGGGG - Intronic
1006418847 6:33920993-33921015 ATGAAGAGCTCAGTGAAAGGAGG + Intergenic
1006643440 6:35500177-35500199 AGGGAGAGGACAGTTAGAGATGG + Intronic
1006896851 6:37476680-37476702 AGGAAGAGAACAGAGTCAGGAGG + Intronic
1007595447 6:43048310-43048332 GGTGAGAGCATGGTGACAGGTGG - Exonic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009935024 6:70223937-70223959 GGGGAGAGCAAAGTGAGAGGAGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010098568 6:72076374-72076396 TGTGAGAGCACAGTGAGAAGGGG - Intronic
1010259286 6:73796564-73796586 AGGGGGAGCTCTGTGACAGTGGG + Intronic
1011550892 6:88530289-88530311 ATGGAGTGCACAGTGTTAGGAGG + Intergenic
1013077313 6:106782790-106782812 AAAGAGAACACAGTGAGAGGGGG - Intergenic
1013466220 6:110419194-110419216 ATGGAGAGCACAGCAAGAGGGGG - Intergenic
1013570344 6:111417487-111417509 AGGAACAGCACAGTGAGAGCGGG - Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015527835 6:134190610-134190632 GGGAAGAGAACAGTGACAAGGGG - Intronic
1015569295 6:134604724-134604746 AGGGACAGAGCAGTGGCAGGTGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017387244 6:153900692-153900714 AGGGAGAACACAGTGAACTGGGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017870489 6:158482516-158482538 AGGGAGAGGACAGATTCAGGAGG + Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018910287 6:168097694-168097716 AGGGAGGGCACAGTCAAAAGAGG - Intergenic
1019228663 6:170537804-170537826 AGGGAGAACACAGAGAGAGATGG + Intronic
1019254571 7:41030-41052 AGGGAGGGCACAGGCACAGCAGG + Intergenic
1019776706 7:2915787-2915809 ATGGTGAGCACAGTGTCAGAGGG - Intronic
1020260298 7:6527084-6527106 GGGGAGAGGACAGAGGCAGGAGG - Intronic
1020273963 7:6614106-6614128 AGTGTGAGCCCAGGGACAGGAGG + Intergenic
1020334888 7:7055727-7055749 AGGAAGAGCACAGAGACACCAGG - Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022332885 7:29396955-29396977 AGGCAGAGCCCAGTCTCAGGGGG - Intronic
1022444418 7:30457977-30457999 AGGGAGGGCAGAGGGGCAGGAGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023170501 7:37386344-37386366 AGGGAGACCACAGAGAAAAGGGG + Intronic
1023873141 7:44273483-44273505 AGGGCAGGCACAGTGACAGGAGG + Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024634801 7:51278275-51278297 AGTGAGAGCCCAGAGCCAGGTGG + Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027174004 7:75891913-75891935 AGGGAGAACAGAGAGCCAGGAGG + Intergenic
1027805221 7:82811379-82811401 AGGTAGATGACAGAGACAGGAGG - Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028306176 7:89268027-89268049 AGGAAGAGCAAAGTGAAATGTGG - Intronic
1028755222 7:94426448-94426470 AGGGAGAGCCCGGTGAAAAGGGG + Exonic
1029649243 7:101879630-101879652 CGGGAGAGCCCACTGTCAGGGGG - Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031560825 7:123235927-123235949 AGGGAGACCACAATGACCAGGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031974394 7:128084692-128084714 AGGAAGAGCACAGTGAGACCTGG - Intronic
1032023573 7:128423637-128423659 ACTGAGAGCACAGTGCCAGGTGG + Intergenic
1032078164 7:128845896-128845918 AGGGAGAGGAGAGGGAAAGGAGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033493185 7:141864553-141864575 AGAGAGGGCAGAGGGACAGGTGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033647702 7:143317867-143317889 AGTGAGAACACAGGGCCAGGGGG - Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034883689 7:154781373-154781395 AGGGAGAACGAAGTGAGAGGGGG - Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035600527 8:894602-894624 GGGGAGAGCAGAGTGACAGCTGG + Intergenic
1036671655 8:10792458-10792480 AGGGAGCGCACAGCGTCACGGGG - Intronic
1037440634 8:18912737-18912759 AAGCAGTGAACAGTGACAGGTGG + Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039511814 8:38097974-38097996 AGAGAGAGCAGAGGGACAGGAGG - Intergenic
1039995187 8:42526221-42526243 AGGGAGATCACAGAGGCAGCAGG - Intronic
1040599743 8:48871439-48871461 AGGGTGAGCCCATGGACAGGAGG + Intergenic
1041222581 8:55666123-55666145 AAGGAAAGCACAGTGACACTGGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041644810 8:60240317-60240339 AGGGAGAACACAGAGACATCAGG + Intronic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1043366503 8:79539243-79539265 AGGGAAAGGACAGTTACAGATGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044836173 8:96297712-96297734 AGGTGGAGCACAGTTACTGGAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1045864399 8:106848786-106848808 ATGGAAAGCACAATCACAGGTGG - Intergenic
1046272314 8:111913029-111913051 ATTAAGATCACAGTGACAGGAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046997567 8:120541380-120541402 ACAGAGAGCAAAGAGACAGGAGG - Intronic
1047256557 8:123217587-123217609 AGGGAGATCACATGGACAGAAGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048411874 8:134183266-134183288 AGGGTGAGCAGAGTGAAAGGTGG + Intergenic
1048582954 8:135745525-135745547 AGGGTGATCACAGGGACAGAGGG + Intergenic
1048830484 8:138472127-138472149 AGAGAGAGGACAGAGACAGGAGG + Intronic
1048974537 8:139663577-139663599 AGAGAGACCACAGAGACAGAGGG + Intronic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049727021 8:144151771-144151793 AGGGGGAGCACAGAGACGGGAGG - Intronic
1050041906 9:1504430-1504452 AGCGGGAGCACACAGACAGGCGG - Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052549348 9:29928313-29928335 AGAGAGAGCATAGAGACAGCAGG + Intergenic
1052716135 9:32119808-32119830 GGGGAGAGCACTGTGAGATGAGG + Intergenic
1053285730 9:36848498-36848520 AGGGAGAGCCCGATGACAGTGGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056840152 9:89992310-89992332 GGGGAAAGCACATTGAAAGGTGG + Intergenic
1056943482 9:90974935-90974957 AGAGAGAGCAGAGTGAGAAGAGG + Intergenic
1057018354 9:91675778-91675800 AGGGGGATCACAATGTCAGGAGG - Intronic
1057313600 9:93955774-93955796 ACGGAGGGCACAGAGGCAGGCGG + Intergenic
1057624870 9:96668059-96668081 AGGTAGAGCACAGGAACAGTGGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059395721 9:114032875-114032897 AGGGAGACCACAGAGGCAGGAGG + Intronic
1059403984 9:114088821-114088843 AGGCAGAGCCCAGGGACAGAAGG - Intronic
1059501867 9:114761733-114761755 AGTGAGACCACAGTGGTAGGTGG - Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061121367 9:128644671-128644693 AAGCAGAGCGCAGTGACACGTGG - Intronic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061495590 9:130972520-130972542 AGACAGAGCACAGAGACAGAGGG - Intergenic
1061495594 9:130972578-130972600 AGACAGAGCACAGAGACAGAGGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061896725 9:133652164-133652186 AGGGAGGACACAGTGGCCGGGGG + Intronic
1061955850 9:133960946-133960968 ATGGTGAGCACAGAGGCAGGAGG + Intronic
1062018020 9:134301529-134301551 AGGGAGGGGACACTGGCAGGGGG - Intergenic
1062401940 9:136376638-136376660 AGGGAGTGCACAGTCACGTGTGG - Intronic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185820650 X:3200454-3200476 AGGGAGTCCAGAGTTACAGGTGG + Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187411442 X:19053883-19053905 AGAGAGAGCCAAGTGAAAGGGGG + Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1190734763 X:53248917-53248939 ACAGAGAGCACAGTTCCAGGAGG - Intronic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192544361 X:72001056-72001078 AGGGAGAGCACAGAGATGTGTGG - Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194257614 X:91653493-91653515 AGAGAGAACACAATGACCGGAGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196186715 X:112751890-112751912 AGGGACAGAAGAGTGAAAGGTGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196516498 X:116618870-116618892 AGGGACAGTACAATGACAGATGG + Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1196762706 X:119213898-119213920 AGGGAGAGGTCAGGGACAGTTGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197710704 X:129665099-129665121 TGGGAAGGCACTGTGACAGGAGG - Intergenic
1198692656 X:139301104-139301126 CTGGAGAGCACAGTGCCATGGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199584881 X:149404549-149404571 AGGAAGAGAAGAGGGACAGGTGG - Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic