ID: 979217448

View in Genome Browser
Species Human (GRCh38)
Location 4:118182461-118182483
Sequence GAGGCATCCCAGATTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979217448_979217451 9 Left 979217448 4:118182461-118182483 CCACAAAAAATCTGGGATGCCTC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 979217451 4:118182493-118182515 ATACAGTAATCTGTGACAACAGG 0: 1
1: 0
2: 0
3: 11
4: 135
979217448_979217453 23 Left 979217448 4:118182461-118182483 CCACAAAAAATCTGGGATGCCTC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 979217453 4:118182507-118182529 GACAACAGGCAAATGATACTGGG 0: 1
1: 0
2: 2
3: 12
4: 197
979217448_979217452 22 Left 979217448 4:118182461-118182483 CCACAAAAAATCTGGGATGCCTC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 979217452 4:118182506-118182528 TGACAACAGGCAAATGATACTGG 0: 1
1: 0
2: 0
3: 17
4: 195
979217448_979217454 27 Left 979217448 4:118182461-118182483 CCACAAAAAATCTGGGATGCCTC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 979217454 4:118182511-118182533 ACAGGCAAATGATACTGGGATGG 0: 1
1: 0
2: 2
3: 21
4: 200
979217448_979217455 28 Left 979217448 4:118182461-118182483 CCACAAAAAATCTGGGATGCCTC 0: 1
1: 0
2: 0
3: 13
4: 132
Right 979217455 4:118182512-118182534 CAGGCAAATGATACTGGGATGGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979217448 Original CRISPR GAGGCATCCCAGATTTTTTG TGG (reversed) Intronic
905960636 1:42039693-42039715 GTGGTTTCCCAAATTTTTTGGGG - Intergenic
916455901 1:164970655-164970677 GATGCAACCTAGATTTTGTGGGG + Intergenic
917113750 1:171580050-171580072 GAGTCATCCTAGGTTTTTTTGGG - Intronic
920990912 1:210938610-210938632 TAGTCATACCAGATTATTTGTGG + Intronic
923754694 1:236780832-236780854 GAGCCATCCCAGCTCTTTTTTGG - Intergenic
924231466 1:241965509-241965531 GGGGGATCCCTGATTTTTGGAGG + Intergenic
1064895421 10:20230282-20230304 TAGGCATTCCAGCTTTTCTGTGG - Intronic
1065229822 10:23586589-23586611 GATGCTTTTCAGATTTTTTGGGG + Intergenic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1066233321 10:33459823-33459845 CAGGCATCCCAGCATTTTCGAGG - Intergenic
1067562733 10:47315200-47315222 GAGGCATTCCAGGTATTTGGGGG - Intergenic
1067832569 10:49618783-49618805 GAGGAAACCCATATTCTTTGGGG - Intronic
1072172553 10:92880085-92880107 CAGTCATCCCAGTTTTTGTGGGG + Intronic
1073281411 10:102357110-102357132 GTGGCCTCCCAGTTTCTTTGTGG - Intronic
1075407928 10:122206899-122206921 GAGGCACCCCAGGTTATTTGTGG + Intronic
1076293774 10:129368039-129368061 CAGGTATCCCAGATGTTCTGTGG - Intergenic
1077258434 11:1601097-1601119 AAAACATCCCAGATTTGTTGTGG - Intergenic
1084803093 11:71558893-71558915 AAAACATCCCAGATTTGTTGTGG + Intronic
1085844882 11:80053581-80053603 GAGGTACCCCACATCTTTTGAGG + Intergenic
1089286464 11:117411000-117411022 GAGGCCTGCCTGATTTCTTGGGG - Intronic
1093937977 12:25021337-25021359 GAGGCATTCCAGATATTTTCTGG - Intronic
1101605175 12:106243023-106243045 TGGGCATCCCACATTTGTTGGGG - Intronic
1102175854 12:110874173-110874195 TAGGCATCCCAGATAGGTTGGGG - Intronic
1102452166 12:113050027-113050049 GAGGCACCCCAGTTTCCTTGAGG - Intergenic
1102705372 12:114875982-114876004 GAAGCATCCCAGTTTCTTTGGGG - Intergenic
1103156314 12:118688178-118688200 GAGGGATCCCACATTCTTTGAGG + Intergenic
1104281070 12:127378199-127378221 CAGGCATACAAGATTTTCTGGGG + Intergenic
1105229292 13:18474728-18474750 GATTCATACCATATTTTTTGTGG - Intergenic
1105620514 13:22061557-22061579 AAGGCCTCCCACAGTTTTTGAGG + Intergenic
1106393642 13:29359622-29359644 GAGGCATCCCATCATCTTTGGGG + Intronic
1108096201 13:46903975-46903997 GAGGCATCACAATTTTTTTGAGG + Intergenic
1109729574 13:66394165-66394187 GAACCATCTCAGATTTTTAGGGG + Intronic
1113169266 13:107481085-107481107 GAGGCAGCCCTGGCTTTTTGAGG + Intronic
1115862635 14:37705787-37705809 GAGGAGTCCCTGATTATTTGGGG + Intronic
1120511388 14:85420215-85420237 AAGCCATGCCAGATTTTTTTTGG - Intergenic
1120526607 14:85584069-85584091 GAGGCAGCCCATATTCTCTGAGG - Intronic
1125097089 15:35867270-35867292 GAGTCAGCCCAGATTTTCTCAGG + Intergenic
1126251449 15:46572576-46572598 GAGGCATGCCACATGTTTAGAGG + Intergenic
1127316188 15:57796349-57796371 AAGGCATCCCAGATGTCTGGGGG - Intergenic
1130390481 15:83449771-83449793 GAGGCATCACAGATTCTCTCTGG + Intronic
1131876500 15:96812498-96812520 GCGACATCCCAGAAATTTTGGGG - Intergenic
1143900523 17:10171077-10171099 GAGGGATCCTGGATTCTTTGCGG - Intronic
1145234173 17:21197109-21197131 CAGGCACCCCAGCCTTTTTGTGG + Intergenic
1145284940 17:21498314-21498336 CAGGCATGCCAGAGTTTTTCAGG - Intergenic
1149146285 17:53497251-53497273 GAGGCATCACAGATATTTCCTGG + Intergenic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1149509671 17:57229654-57229676 GAAGCATCCCAGCTTTATGGTGG + Intergenic
1154033840 18:10779105-10779127 GAGGCCTGTCAGGTTTTTTGGGG - Intronic
1154524159 18:15265395-15265417 GATTCATACCATATTTTTTGTGG + Intergenic
1155812146 18:30250310-30250332 GAGGCATGCCAAATATTTGGTGG + Intergenic
1157494412 18:48144999-48145021 GAGGCATTCCTGGTTCTTTGGGG + Intronic
1159682615 18:71373350-71373372 GAGTCATGTCAGATTTTTTAAGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1165110169 19:33497749-33497771 GAGGTATCCCAGGTTGCTTGAGG - Intronic
1166259843 19:41630103-41630125 AAGGCATGCCAGGTTTTCTGGGG - Intronic
1167378394 19:49124725-49124747 GATGCAACACAGATGTTTTGGGG - Intronic
1168238236 19:55076538-55076560 GCGGCAGCCCAGACTGTTTGCGG + Intronic
926296424 2:11572340-11572362 GAGGCATCCCTGAGGTTTTGTGG + Intronic
930624663 2:53683139-53683161 GAGGCATACCCGGTTTTTTGAGG + Intronic
930740173 2:54824334-54824356 TAGACATTCCAGATTCTTTGAGG - Intronic
932550351 2:72763653-72763675 GAGGCAGGGCAGATTGTTTGAGG - Intronic
932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG + Intergenic
939617131 2:144374415-144374437 AAGGCATCCCGGATTATTTTGGG + Intergenic
942426534 2:175866281-175866303 GAGGCATCTCACCTCTTTTGGGG - Intergenic
943701988 2:190996651-190996673 TAGGTACCCCAGATTTCTTGTGG - Intronic
944399712 2:199311382-199311404 GAAGTATCACAGATTTCTTGGGG - Intronic
945718977 2:213394739-213394761 GAGTCATCCAAGATGTTGTGTGG + Intronic
949007100 2:241655976-241655998 CTGGCATCCCAGCATTTTTGGGG + Intronic
1169651546 20:7873831-7873853 GAGTCTTCCAATATTTTTTGTGG + Intergenic
1170637173 20:18117333-18117355 GAGGCAGACCAGATTGCTTGAGG + Intergenic
1172681904 20:36722795-36722817 GAGCCATCCCTGATTTATTTGGG - Intronic
1175464292 20:59179495-59179517 AAGGCATCCTTGATTTTTAGAGG + Intergenic
1175659750 20:60802537-60802559 GAAGTATTCCAGATTTTTTCAGG - Intergenic
1176773282 21:13103082-13103104 GATTCATACCATATTTTTTGTGG - Intergenic
1178263748 21:31123713-31123735 GAGGCAGCCCAGAATTTTGCAGG - Intronic
1180860204 22:19074779-19074801 GGGGCATCCCAGATCTGTAGAGG - Intronic
1180914675 22:19477848-19477870 GAACCATCCCAGATTTTAGGCGG - Intronic
1182360020 22:29740801-29740823 GAGGGATCCCAGAATCTTAGGGG + Intronic
1182729296 22:32474618-32474640 CTGGCATCCCAGATTTTCCGCGG - Intergenic
1183937053 22:41268643-41268665 GAGGCCTCCAAGAGTTATTGGGG + Intronic
951564246 3:23997190-23997212 GACGCATGCAAGGTTTTTTGAGG + Intergenic
955149086 3:56349035-56349057 GTTGAATCACAGATTTTTTGAGG - Intronic
955494906 3:59520973-59520995 GAGGCAGGGCAGATTTCTTGAGG - Intergenic
956235406 3:67064305-67064327 GAGTCATCCCAGGTTATTTCAGG - Intergenic
956854161 3:73259529-73259551 GAGGCAGTGCAGATTTTTGGAGG - Intergenic
957228258 3:77476685-77476707 CAGGCATGCCAGATTTTCGGTGG + Intronic
959148894 3:102584446-102584468 GAGTCTTCCCAGGTTCTTTGGGG + Intergenic
959729649 3:109586226-109586248 GAGGAATCTCATATTTTTCGGGG + Intergenic
968595710 4:1481761-1481783 TATGCATCTCATATTTTTTGTGG + Intergenic
968670805 4:1850304-1850326 GAGGCTTCCCATCTTTTTTTAGG - Intronic
968860717 4:3167071-3167093 GAAGCATCCCTTGTTTTTTGAGG + Intronic
969560090 4:7941264-7941286 GAGGCATCTCAAATTTTCTGCGG + Intergenic
969947653 4:10801029-10801051 GAGGAATCCCAGACATTGTGAGG - Intergenic
970472940 4:16394543-16394565 GAGGCATCCCAGGTTTTTCCAGG + Intergenic
972101676 4:35427729-35427751 GAGACATACCAGATTTTGTGAGG - Intergenic
972149927 4:36076814-36076836 TAGGCATCTCAAATTTTATGTGG + Intronic
977066545 4:92323600-92323622 CTGGCATCCCAGGTTTTTTGTGG + Intronic
979217448 4:118182461-118182483 GAGGCATCCCAGATTTTTTGTGG - Intronic
979795024 4:124834999-124835021 GAGACATCCCAAATATTGTGAGG - Intergenic
981548049 4:145914930-145914952 GAAGCATCCGAGTTTTATTGGGG - Intronic
982317365 4:154045276-154045298 GAGGCTTCCAAGATTGTTTCAGG + Intergenic
985028241 4:185760684-185760706 AAGGCAGCCGAGCTTTTTTGTGG - Intronic
990470769 5:56113177-56113199 GAGGGATCCCCGACTTTTTAAGG + Intronic
990832894 5:59980402-59980424 GGGGAATCCCATATTTTTTAAGG - Intronic
991399462 5:66237851-66237873 GAGGCTTTGCAGATCTTTTGTGG + Intergenic
991937229 5:71814500-71814522 GACACATGCCAGATTTTTGGAGG + Intergenic
992602236 5:78414170-78414192 GAGACTTCCCAGATATTTTATGG + Intronic
996060822 5:119031274-119031296 TAGGTATGCCACATTTTTTGAGG - Intergenic
998496506 5:142594882-142594904 GAGCCATGCCAGATGTTTGGGGG + Exonic
998761529 5:145437670-145437692 CAGGCCTCCCAGATTTTTCTGGG - Intergenic
1000257862 5:159558031-159558053 AAGGCATCCCAGATTTTAAAGGG - Intergenic
1000614995 5:163416591-163416613 GAGGAATCCCAGGTTTTGCGCGG + Intergenic
1002200839 5:177527223-177527245 GCTGTAGCCCAGATTTTTTGGGG + Intronic
1004933351 6:20483303-20483325 TTGGCTTCCCAGATTTTTGGTGG + Intronic
1005567090 6:27107150-27107172 GGGGCATCCTATATTTTATGTGG + Intergenic
1006584341 6:35096768-35096790 AAGGCATGCCAGGTTTTCTGAGG + Intergenic
1006632094 6:35436868-35436890 GATGCATCCCAAATTCTTAGAGG - Intergenic
1007164840 6:39821940-39821962 GAGACAACGCAGATTTCTTGGGG - Intronic
1010009762 6:71036488-71036510 GAGGTATACCAGAAGTTTTGTGG - Intergenic
1012896829 6:104958155-104958177 GAGGAATCCCAGGTTTTGCGCGG + Exonic
1013679971 6:112514334-112514356 GAGGGATAACAGATTTGTTGAGG + Intergenic
1019077220 6:169397386-169397408 GAGGCATGTCAGATTGTCTGAGG - Intergenic
1019300572 7:301504-301526 GAGGCATCTCATATTTAATGGGG + Intergenic
1020800557 7:12727391-12727413 GATGCATCCCAGTTTTGTTAAGG + Intergenic
1021487652 7:21184439-21184461 GAGGCTACCTAGATTCTTTGGGG - Intergenic
1023476703 7:40587161-40587183 GAGACACAACAGATTTTTTGGGG + Intronic
1024300932 7:47887115-47887137 GAGGCATTCCAAATTCTTTTAGG - Intronic
1028312587 7:89357484-89357506 GTGGCATCCGTGATTATTTGGGG - Intergenic
1028572107 7:92301870-92301892 AAGGCATCCCAGATTATATGAGG - Intronic
1028610184 7:92701703-92701725 GAAGCATTCCATATTTTTTTTGG - Intronic
1035410856 7:158639644-158639666 AAGTCATCCCAGATTTCTGGGGG + Intronic
1036251391 8:7165802-7165824 GAGGGATCCCAGTGATTTTGAGG + Intergenic
1036366097 8:8121658-8121680 GAGGGATCCCAGTGATTTTGAGG - Intergenic
1038555636 8:28511693-28511715 TAGGCATCCCAGATTTCTTAAGG - Intronic
1041095887 8:54349524-54349546 GAGGCATCGTAGATTTTTGTGGG - Intergenic
1042696430 8:71558407-71558429 GAGGCCTCCTAGAATTTCTGGGG + Intronic
1044475997 8:92627229-92627251 GAGGCATCATAGAATGTTTGTGG + Intergenic
1047042344 8:121009871-121009893 GAGACTTCCCAGAGTGTTTGAGG + Intergenic
1047998139 8:130356744-130356766 GAGGGATCCCAAATTTTAGGAGG - Intronic
1049042220 8:140121115-140121137 GAGGCATCCCTGATATCCTGAGG - Intronic
1057578687 9:96266271-96266293 GAGGAATCCCAAATTGTTTTTGG + Intronic
1192752399 X:74007250-74007272 CAGACATTCCAGTTTTTTTGTGG - Intergenic
1195413763 X:104597801-104597823 GAGGCACAGCAGGTTTTTTGGGG + Intronic
1195888285 X:109665077-109665099 GAGAAACCCCAGATTTTTAGGGG - Intronic
1198816497 X:140597242-140597264 GAGGAATCCTAGAATGTTTGAGG + Intergenic
1199833392 X:151565084-151565106 CAGGCATCCTGGTTTTTTTGAGG + Intronic