ID: 979228039

View in Genome Browser
Species Human (GRCh38)
Location 4:118312833-118312855
Sequence TCTAGTGAGCTATTTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979228039_979228046 23 Left 979228039 4:118312833-118312855 CCTATCCCAAATAGCTCACTAGA 0: 1
1: 0
2: 2
3: 6
4: 91
Right 979228046 4:118312879-118312901 ATAAGTGACCGAGGAGTAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
979228039_979228044 21 Left 979228039 4:118312833-118312855 CCTATCCCAAATAGCTCACTAGA 0: 1
1: 0
2: 2
3: 6
4: 91
Right 979228044 4:118312877-118312899 GAATAAGTGACCGAGGAGTAAGG No data
979228039_979228045 22 Left 979228039 4:118312833-118312855 CCTATCCCAAATAGCTCACTAGA 0: 1
1: 0
2: 2
3: 6
4: 91
Right 979228045 4:118312878-118312900 AATAAGTGACCGAGGAGTAAGGG 0: 1
1: 0
2: 1
3: 7
4: 74
979228039_979228043 14 Left 979228039 4:118312833-118312855 CCTATCCCAAATAGCTCACTAGA 0: 1
1: 0
2: 2
3: 6
4: 91
Right 979228043 4:118312870-118312892 AAAATCAGAATAAGTGACCGAGG 0: 1
1: 0
2: 0
3: 22
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979228039 Original CRISPR TCTAGTGAGCTATTTGGGAT AGG (reversed) Intronic