ID: 979228039 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:118312833-118312855 |
Sequence | TCTAGTGAGCTATTTGGGAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 100 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 6, 4: 91} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
979228039_979228046 | 23 | Left | 979228039 | 4:118312833-118312855 | CCTATCCCAAATAGCTCACTAGA | 0: 1 1: 0 2: 2 3: 6 4: 91 |
||
Right | 979228046 | 4:118312879-118312901 | ATAAGTGACCGAGGAGTAAGGGG | 0: 1 1: 0 2: 0 3: 6 4: 82 |
||||
979228039_979228044 | 21 | Left | 979228039 | 4:118312833-118312855 | CCTATCCCAAATAGCTCACTAGA | 0: 1 1: 0 2: 2 3: 6 4: 91 |
||
Right | 979228044 | 4:118312877-118312899 | GAATAAGTGACCGAGGAGTAAGG | No data | ||||
979228039_979228045 | 22 | Left | 979228039 | 4:118312833-118312855 | CCTATCCCAAATAGCTCACTAGA | 0: 1 1: 0 2: 2 3: 6 4: 91 |
||
Right | 979228045 | 4:118312878-118312900 | AATAAGTGACCGAGGAGTAAGGG | 0: 1 1: 0 2: 1 3: 7 4: 74 |
||||
979228039_979228043 | 14 | Left | 979228039 | 4:118312833-118312855 | CCTATCCCAAATAGCTCACTAGA | 0: 1 1: 0 2: 2 3: 6 4: 91 |
||
Right | 979228043 | 4:118312870-118312892 | AAAATCAGAATAAGTGACCGAGG | 0: 1 1: 0 2: 0 3: 22 4: 157 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
979228039 | Original CRISPR | TCTAGTGAGCTATTTGGGAT AGG (reversed) | Intronic | ||