ID: 979228725

View in Genome Browser
Species Human (GRCh38)
Location 4:118321744-118321766
Sequence TTCCCCCAACTTTACTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979228725_979228730 -10 Left 979228725 4:118321744-118321766 CCCAAAAAGTAAAGTTGGGGGAA 0: 1
1: 0
2: 3
3: 31
4: 352
Right 979228730 4:118321757-118321779 GTTGGGGGAATGGTAAGGAAGGG 0: 1
1: 0
2: 5
3: 95
4: 465
979228725_979228731 20 Left 979228725 4:118321744-118321766 CCCAAAAAGTAAAGTTGGGGGAA 0: 1
1: 0
2: 3
3: 31
4: 352
Right 979228731 4:118321787-118321809 ATCAATATCTTAACATTTTCTGG 0: 1
1: 0
2: 2
3: 39
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979228725 Original CRISPR TTCCCCCAACTTTACTTTTT GGG (reversed) Intronic
901548745 1:9979303-9979325 TTCAGCTAACTTTAGTTTTTTGG - Intronic
905331642 1:37206213-37206235 TTCCCTCCTCTTTAATTTTTTGG - Intergenic
906449627 1:45933916-45933938 TTTCCCCAACTTTAGCTTTAGGG + Intronic
908279512 1:62517233-62517255 TTCCCCTAAATTTCCATTTTAGG + Intronic
908493492 1:64670342-64670364 TTCCCCAAGCTTTAGTTTTCTGG + Intronic
909383158 1:75024553-75024575 TTCCACCTCCTCTACTTTTTCGG - Intergenic
909431033 1:75588172-75588194 TTCTCCTAACTCCACTTTTTTGG - Intronic
911446941 1:98007334-98007356 TTCCACTAACTTTAGTTATTTGG - Intergenic
912662798 1:111548532-111548554 TTTGCACAACTTTAATTTTTCGG + Intronic
913415969 1:118607694-118607716 TTCCCCTATGTTTAGTTTTTGGG + Intergenic
913710846 1:121481817-121481839 TGCCTCCAGCTTTGCTTTTTTGG - Intergenic
914067682 1:144258867-144258889 TTCCCCCAACTCTACTTGGCTGG + Intergenic
914111473 1:144707487-144707509 TTCCCCCAACTCTACTTGGCTGG - Intergenic
916278127 1:163017454-163017476 TTCCCTCCACTTCATTTTTTTGG + Intergenic
917297299 1:173533829-173533851 TCCCCCCAACATTACTGTATAGG - Intronic
917833907 1:178924726-178924748 TTCCCTCAGCTTTAATTTTTTGG - Intergenic
917838830 1:178961328-178961350 TTCCCCCAAAAGTACATTTTGGG + Intergenic
917838833 1:178961331-178961353 TTCCCCAAAATGTACTTTTGGGG - Intergenic
918051768 1:180979491-180979513 TGCCTCCAACTTCATTTTTTTGG - Intronic
918812153 1:189136313-189136335 TTCTCCCAATTTTACTTGTTTGG + Intergenic
918942133 1:191014524-191014546 TTCCCCCATCCTTAGTTTTCTGG - Intergenic
919233023 1:194800262-194800284 TCCCCCCAACTTTTCTTGTTAGG - Intergenic
919489750 1:198192205-198192227 TTCCCCCCACATTTCTTATTTGG + Intronic
919528930 1:198691460-198691482 TTCCCCCAACCTTTCTTTTGGGG + Intronic
919584860 1:199424125-199424147 TTCCCTCATCTTTGCTTTTTTGG - Intergenic
920707240 1:208262045-208262067 TTTGCTCAACTTTAATTTTTTGG + Intergenic
920986283 1:210892674-210892696 TTGTCCAAACTTTAGTTTTTTGG - Intronic
921928434 1:220732801-220732823 TTCCTCACACTTTCCTTTTTAGG - Intergenic
922393792 1:225175622-225175644 TTCTCTCATCTTTATTTTTTGGG + Intronic
924576574 1:245286077-245286099 TTCCCCCAGCTTTGCTACTTTGG + Intronic
1063106841 10:2999491-2999513 TTCCACCACCTTTTCGTTTTTGG + Intergenic
1063559497 10:7113155-7113177 TGACCCCAACATAACTTTTTTGG - Intergenic
1065518423 10:26547875-26547897 TTCCCTCAATGTGACTTTTTTGG + Intronic
1065580921 10:27171229-27171251 TTCTACCAGCTTTACTTTTCTGG - Intronic
1067909226 10:50327928-50327950 TTACCCCTATTTTACTTCTTAGG - Intronic
1067997890 10:51296206-51296228 TTCCTCCTATTTTATTTTTTTGG + Intronic
1068266440 10:54656331-54656353 CACCCCCACCTATACTTTTTTGG - Intronic
1068815859 10:61311716-61311738 TTCCCTCCTCTTTAATTTTTTGG + Intergenic
1070665699 10:78341961-78341983 TTACCCCAATTTTACTTATGAGG - Intergenic
1070842749 10:79499049-79499071 TTCCCTCCTCTTTAATTTTTGGG + Intergenic
1071050729 10:81445258-81445280 TTCCTCCAGTTTTACTCTTTTGG + Intergenic
1075004938 10:118823338-118823360 CTCCCCCAACTTCAGATTTTGGG - Intergenic
1075199411 10:120389709-120389731 CTTCCCCAACTCTACTTCTTGGG - Intergenic
1076338211 10:129724847-129724869 TTCCCCCAAATTTGCTTTCAAGG - Intronic
1076925799 10:133485220-133485242 TTCCCTCTGCTTTAATTTTTTGG + Intergenic
1077459822 11:2703429-2703451 TCCCTCCAGCTTTACTCTTTGGG + Intronic
1077682648 11:4258160-4258182 TTCCCTCCTCTTTAGTTTTTTGG + Intergenic
1077687388 11:4308577-4308599 TTCCCTCCTCTTTAGTTTTTTGG - Intergenic
1077692556 11:4359768-4359790 TTCCCTCCTCTTTAGTTTTTTGG - Intergenic
1077845474 11:6019132-6019154 TTCCCTCCTCTTTAATTTTTTGG - Intergenic
1077999323 11:7480836-7480858 ATCTCCCAAATTTACTCTTTAGG + Intergenic
1078443847 11:11389465-11389487 TTGCCCCACCTTTACTTTACAGG - Intronic
1078518868 11:12047569-12047591 TGCCCCAAACTGTTCTTTTTTGG - Intergenic
1079276898 11:19048023-19048045 TTCTCTCATCTTTAATTTTTTGG - Intergenic
1079636808 11:22752638-22752660 TTCCTCCTCCTTTTCTTTTTTGG - Intronic
1080083335 11:28248329-28248351 TTACCCCAACTTTCCTTGCTAGG - Intronic
1082094684 11:48119796-48119818 TTACACCATCTTTACTCTTTTGG + Intronic
1082991622 11:59211782-59211804 TTCTCCCAACTTCAATTTTCAGG - Exonic
1084038317 11:66526853-66526875 TTCCCCCAGCTTTGCTGTGTAGG - Intronic
1086144772 11:83539600-83539622 TTCTGCCAAATTTTCTTTTTAGG - Intronic
1086780719 11:90901695-90901717 TTCCCCCACCCTTACTTTCTTGG + Intergenic
1086793986 11:91077397-91077419 TTGCCCCACTTTTACTTTTCTGG + Intergenic
1086817783 11:91394593-91394615 ATCCCCCCAGTTTACTTTGTGGG + Intergenic
1086836747 11:91633960-91633982 TGCCCCCAAATGTATTTTTTAGG - Intergenic
1086870519 11:92031448-92031470 TGCCCCCAACTTTGTTCTTTTGG - Intergenic
1086875895 11:92095208-92095230 TGCCCCCAACTTTGTTCTTTTGG - Intergenic
1087460146 11:98435568-98435590 TTCCTCCAGCTTTGCTCTTTTGG - Intergenic
1089058245 11:115605289-115605311 TTCCCCAAACTTCACTCATTTGG + Intergenic
1089570042 11:119400861-119400883 TTCCCCCAGCTTCAAATTTTTGG - Intergenic
1089925291 11:122250879-122250901 TTCCCACAAATTTAGTTGTTTGG + Intergenic
1090256193 11:125286418-125286440 TTACCCCAAATTCACTTTGTTGG - Intronic
1091667844 12:2431996-2432018 TTCCCACAACTTCCCTTTTAAGG + Intronic
1092158357 12:6299913-6299935 TTCCCCCTTCTTTTTTTTTTTGG - Intergenic
1093045110 12:14434199-14434221 CTCCCCAAATTTTACATTTTGGG + Intronic
1093621612 12:21296995-21297017 TTCCTCCTAATTTAATTTTTTGG - Intronic
1094758763 12:33503179-33503201 TTCCCTCATCTTCAATTTTTTGG + Intergenic
1097477036 12:60070917-60070939 TTCAGCCAACTTTAATTTCTTGG + Intergenic
1098756774 12:74373717-74373739 TTCCACCAACATTCCATTTTGGG + Intergenic
1099119650 12:78672306-78672328 TTCCCTCACTGTTACTTTTTAGG + Intergenic
1099516853 12:83607447-83607469 TTTCCCCAACTTTATGTTTTTGG - Intergenic
1099614869 12:84921288-84921310 TGCCCCCAACTTTACTTTATAGG + Intergenic
1099625546 12:85068473-85068495 TTGCTTCATCTTTACTTTTTTGG + Intronic
1101623786 12:106418197-106418219 TTCACCTACCTTTTCTTTTTCGG + Intronic
1102657465 12:114494616-114494638 TTCTCCCATCTTTTCTTTCTTGG - Intergenic
1102856733 12:116300575-116300597 TTCCCCCAAATTGCCATTTTGGG + Intergenic
1103460331 12:121098891-121098913 TTCCCTCCTCTTTAGTTTTTTGG - Intergenic
1103685484 12:122729121-122729143 TTCACACAACTATACCTTTTGGG - Exonic
1104788006 12:131462433-131462455 TTTGCTCAACTTTAATTTTTTGG + Intergenic
1105552808 13:21413384-21413406 TTCCCCCAACTCAACTTTCATGG - Intronic
1106485577 13:30169422-30169444 TTCCCCAGATTTTACTTTTATGG - Intergenic
1107742972 13:43473335-43473357 TTCCCTTAACTTTTCTTTTTTGG + Intronic
1108089503 13:46833173-46833195 TTCCCCCTCCTTTATTTGTTTGG + Exonic
1110009821 13:70318014-70318036 TTCCCCCATCATTAATTTCTTGG + Intergenic
1111167815 13:84485259-84485281 TTCTTACAATTTTACTTTTTTGG - Intergenic
1111417944 13:87974426-87974448 TTTACTCAACTTTACTTTCTAGG + Intergenic
1111507310 13:89209050-89209072 CTCACCCAGCTTTACTTTTCAGG + Intergenic
1111793437 13:92887733-92887755 CTCCCCCAACTTGACTTCTAAGG - Intergenic
1112069424 13:95832124-95832146 TTTCCTCAGCTTTACTGTTTAGG - Intronic
1112656518 13:101457327-101457349 TTATCCCTACTTGACTTTTTGGG - Intronic
1112689288 13:101871674-101871696 TTCCCCCCACTTTGCTTTTGGGG - Intronic
1112821470 13:103341833-103341855 TTCCCTCCTCTTTAGTTTTTTGG + Intergenic
1114052314 14:18930767-18930789 TTCTCCCAGCCTTTCTTTTTGGG + Intergenic
1114110243 14:19471158-19471180 TTCTCCCAGCCTTTCTTTTTGGG - Intergenic
1115044602 14:28975951-28975973 TTCCCTTAACTTCACTTTCTGGG + Intergenic
1116319134 14:43437186-43437208 TTCTCCCAACATTAATTTTAAGG + Intergenic
1117200334 14:53383525-53383547 TTACCTCAACTTTTTTTTTTAGG + Intergenic
1118689107 14:68321165-68321187 TCCCCCTAGTTTTACTTTTTTGG - Intronic
1118865743 14:69702308-69702330 TGCCCCCACTTTTACTGTTTTGG + Intronic
1119015557 14:71050077-71050099 TTCCCCAAACTTTAGTGCTTTGG - Intronic
1119326671 14:73763824-73763846 TTCCCTGAACCTCACTTTTTAGG + Intronic
1119355000 14:73999086-73999108 TTTCCTCACCTTTACTTTTCTGG - Intronic
1119754040 14:77101316-77101338 CTCCCCAAACTTTACTCTTTCGG - Intronic
1119936942 14:78600620-78600642 TTCCCCCAACATTATCTTTCTGG + Intronic
1120815221 14:88849826-88849848 TTTCCCCACCTTTCCCTTTTTGG + Intronic
1120845007 14:89117723-89117745 TTTCCCCAACTTCTCATTTTGGG - Intergenic
1122196393 14:100089945-100089967 TTTCCCCATATGTACTTTTTGGG - Intronic
1122358472 14:101139695-101139717 TTCTCACATCTTCACTTTTTTGG + Intergenic
1202938805 14_KI270725v1_random:122199-122221 TTCTCCCAATTTTAATTATTTGG - Intergenic
1126045998 15:44640512-44640534 TTCCTTAATCTTTACTTTTTAGG - Intronic
1126943359 15:53790267-53790289 TACCCACAATTTTACTTTGTAGG + Intergenic
1127058620 15:55158757-55158779 TTCCCACCACTTCAGTTTTTTGG - Intergenic
1128258909 15:66218152-66218174 TTCCCCCATTTTTAAATTTTGGG - Intronic
1129316010 15:74744637-74744659 GTCCCCCACCTACACTTTTTTGG - Intergenic
1129630263 15:77251362-77251384 TTCCCTCTCCTTTACTATTTTGG + Intronic
1130324096 15:82865288-82865310 CTCCCTCACCTTTTCTTTTTGGG + Intronic
1130700465 15:86175037-86175059 TTCCCTCCTCTTTAATTTTTTGG + Intronic
1130863947 15:87915982-87916004 TACCTCCAACTTTGCTCTTTGGG + Intronic
1131004472 15:88965823-88965845 TTCCCTCCACTTGAATTTTTTGG + Intergenic
1131572569 15:93553919-93553941 TGCCCCCAACTTTGCTCCTTCGG + Intergenic
1136015402 16:27396720-27396742 GTCCTCCAACTTTATTGTTTTGG - Intergenic
1136017729 16:27415206-27415228 TTTGCCCAACTTTAATTTTTTGG - Intronic
1136160357 16:28415749-28415771 ATCCTCCAACTTTTTTTTTTTGG - Intergenic
1136168415 16:28472029-28472051 ATCCTCCAACTTTTTTTTTTTGG - Intergenic
1137221863 16:46461489-46461511 TTCTCCCAACGTTAGTTATTTGG - Intergenic
1137274463 16:46924417-46924439 TTCCGTCAGCTTTGCTTTTTTGG - Exonic
1137678925 16:50321641-50321663 TAACCTCAACATTACTTTTTAGG + Intronic
1138163193 16:54775470-54775492 TTCCCTCAACTCTACTATTGAGG - Intergenic
1140622994 16:76758812-76758834 TTCCTCCAACTTTGTTCTTTTGG - Intergenic
1140632422 16:76870170-76870192 TTCCTCCAACTTTTCTTCATAGG + Intergenic
1144054845 17:11531282-11531304 TTTCCCCCAAATTACTTTTTTGG + Intronic
1144054846 17:11531283-11531305 TTCCCCCAAATTACTTTTTTGGG + Intronic
1144215648 17:13052800-13052822 GACCCGCAATTTTACTTTTTTGG - Intergenic
1144376918 17:14652046-14652068 TCCCCCCATCTGTTCTTTTTCGG - Intergenic
1146408304 17:32559152-32559174 TTTCCTGAACTTTACTTGTTGGG + Intronic
1146428784 17:32770104-32770126 TTACAACAACTTTACTTTTATGG - Intronic
1148942191 17:51224456-51224478 TTCCTCCAACTTTTATCTTTTGG - Intronic
1148984039 17:51605983-51606005 TGTCCCCAACTGTACTTTTCTGG - Intergenic
1149200395 17:54178924-54178946 TTCCCACATCTTTATTTATTTGG + Intergenic
1150527137 17:65936379-65936401 TTCCCTCTACTTCAGTTTTTTGG - Intronic
1150736028 17:67740232-67740254 TTCCCCCCGCTTTTTTTTTTTGG - Intronic
1152343226 17:79736850-79736872 TTCCCTGAACTTCACTCTTTAGG + Intronic
1156730567 18:40189078-40189100 TTCCTCCAGCTTTGTTTTTTTGG + Intergenic
1157137848 18:45074797-45074819 TTCCCCTAACTGTAATTTCTGGG + Intergenic
1157788329 18:50506875-50506897 TTTCCCCAATTTTTCTTATTGGG - Intergenic
1158275459 18:55762188-55762210 CTCCCCCAACTTTTATTTTTTGG + Intergenic
1158665640 18:59430255-59430277 TCCCTCCAACTTTATTTTTAAGG + Intergenic
1159322759 18:66875350-66875372 TGGCCCCATCTTTACTTTTACGG + Intergenic
1161131449 19:2591552-2591574 TTCCCCCAACTTTGGTTCTTTGG - Intronic
1162811234 19:13165274-13165296 TTCCCCCAACATGACTTCTCAGG - Intergenic
1163286982 19:16354970-16354992 TTTAACCAACTTTATTTTTTAGG - Intergenic
1165420610 19:35720279-35720301 TTGTCCCATCTTTACTTTTTTGG - Exonic
1166817369 19:45554287-45554309 TAGCCCCAACTTTGCATTTTGGG - Intronic
1167343615 19:48931363-48931385 CTCCCCCCACTTTTTTTTTTTGG + Intergenic
1168536585 19:57175407-57175429 TTATCCCAAGTTTTCTTTTTTGG - Intergenic
925747307 2:7054589-7054611 TTCCCCCAAATTTATATGTTGGG + Intronic
926402096 2:12507702-12507724 TTCCCCCAAAGTCACATTTTGGG - Intergenic
927265522 2:21144968-21144990 TTCCTCCTCCTTTTCTTTTTTGG - Intergenic
928334612 2:30385868-30385890 TTCCCCAAATTTTCCTTTATAGG - Intergenic
928727565 2:34192280-34192302 TTCCTGCAACTTTTCTGTTTTGG - Intergenic
929408767 2:41672800-41672822 TTCCCCCAAGTTTTTTCTTTGGG - Intergenic
929527007 2:42713937-42713959 TGGCCCCAACTTTAACTTTTAGG - Intronic
929984878 2:46718917-46718939 TTTGCCCAAGTTTAATTTTTAGG + Intronic
930588097 2:53294143-53294165 TTCCCTCCTCTTTAATTTTTTGG - Intergenic
930860492 2:56066767-56066789 TTCCCCCTCCTTCAGTTTTTTGG + Intergenic
931079122 2:58749808-58749830 TTGCCCCCATTTTTCTTTTTTGG + Intergenic
931250327 2:60525256-60525278 TTTCTCCAAGTTTGCTTTTTTGG - Intronic
931602832 2:64020431-64020453 TTTCCCCAACTTTAGCTCTTTGG - Intergenic
931641915 2:64388558-64388580 TTCCCCCAACTAGATTGTTTTGG + Intergenic
931723980 2:65091112-65091134 TTTCCCCAACTTTATTTTAATGG - Intronic
933345156 2:81075116-81075138 TTTCCCCAAATCTAATTTTTTGG - Intergenic
933970233 2:87464078-87464100 TCCCTCAAACTTTACTCTTTTGG + Intergenic
935126897 2:100232255-100232277 TTCCCCCTAAGTTACTTATTGGG + Intergenic
936323548 2:111486418-111486440 TCCCTCAAACTTTACTCTTTTGG - Intergenic
936372780 2:111917058-111917080 TTCCCCCTACTCTAGTGTTTGGG - Intronic
936752026 2:115654910-115654932 TTCCCACAACTTTGACTTTTAGG + Intronic
937488940 2:122345464-122345486 TTCCCCCATCTTTGCTTGATTGG - Intergenic
937733428 2:125261319-125261341 TTCCCCCCACCTAACTATTTGGG + Intergenic
937951505 2:127391349-127391371 TTCCCCCTTCTTTACTGTGTGGG - Intergenic
938255006 2:129850803-129850825 TTCCAACAACCTTCCTTTTTGGG - Intergenic
939124993 2:138166730-138166752 TTCCCTCAAATATATTTTTTAGG - Intergenic
940755352 2:157675585-157675607 TTGCCTCAAGTTTACTTTCTGGG + Intergenic
941377385 2:164748339-164748361 TTCTCCTAACATTAATTTTTTGG + Intronic
941674868 2:168333127-168333149 TTCCCTCTGCTTTAATTTTTTGG - Intergenic
942490324 2:176483472-176483494 TTCCCCCAGCTTAAGTGTTTGGG - Intergenic
944755839 2:202760867-202760889 TTAGCCCAAATGTACTTTTTTGG + Intronic
944919190 2:204393612-204393634 TTCCCTCGTCTTTAATTTTTTGG + Intergenic
945223854 2:207511725-207511747 TCCCCTGAACTTTACTTTTTTGG - Intergenic
945381712 2:209147964-209147986 TTCCCCCATTTTTACATATTAGG - Intergenic
945781410 2:214177557-214177579 TTCTCCCAACTCTATTTTTTAGG + Intronic
947377132 2:229507874-229507896 TTTCTCAAACTTTACTTTTCTGG - Intronic
947987024 2:234457059-234457081 TACCCCAAAATATACTTTTTTGG - Intergenic
1169598116 20:7224268-7224290 TTCCTCCAACTTTGCTCTTTTGG + Intergenic
1169763711 20:9125895-9125917 TTCCCTGAAGTTTACTTTGTTGG + Intronic
1170108939 20:12783925-12783947 GTCCCCCAATTTCACTTCTTTGG + Intergenic
1170316809 20:15051275-15051297 TTCCCCCAACTTTATCAGTTAGG + Intronic
1173637069 20:44569350-44569372 TTCCACCAACCTTCCTTCTTTGG + Intronic
1173762351 20:45574314-45574336 TTCCCTCCACTTCAATTTTTTGG - Intronic
1175343031 20:58246970-58246992 GTCTCCCAAATGTACTTTTTTGG - Intergenic
1177429970 21:20979580-20979602 TTCCCTCTTCTTTAATTTTTTGG + Intergenic
1178446613 21:32649577-32649599 TTACCTCAACTTTAATTATTGGG + Intronic
1178974781 21:37212035-37212057 TTAAGCCAACTTTACTTTCTTGG + Intergenic
1179611050 21:42550559-42550581 TTCCCCCCACTTTTATTTTTTGG - Intronic
1180470788 22:15653142-15653164 TTCTCCCAGCCTTTCTTTTTGGG + Intergenic
1182195689 22:28514411-28514433 TTCTCCCAGCTTTACTTTAATGG + Intronic
949099706 3:129243-129265 TTGCCCCAACTCTATATTTTTGG + Intergenic
950717105 3:14856309-14856331 TGCCCCCAGCTTTATTCTTTTGG + Intronic
951021615 3:17787084-17787106 TTCCCTCATCTTAAATTTTTTGG + Intronic
951401529 3:22238240-22238262 GTCTTCCAACTTTGCTTTTTTGG + Intronic
951714418 3:25624054-25624076 TCTCACCAACTTTACTCTTTAGG - Intronic
951916913 3:27810948-27810970 TTCCCCCAAATTTGGTTCTTAGG + Intergenic
953737189 3:45505685-45505707 TTCCCCCAACTTTTTTTTGTAGG - Intronic
954629374 3:52039873-52039895 TTCCCACACCTTTGCCTTTTGGG - Intergenic
956106572 3:65825020-65825042 TTCCCTCTTCTTTACTTTATGGG - Intronic
957125114 3:76148803-76148825 TTCCTCCACTTTTCCTTTTTTGG + Intronic
957217339 3:77337358-77337380 TTACCCCAAGTTTAATATTTTGG - Intronic
957311947 3:78531713-78531735 TTCCTCCAATTTAACTTTTATGG + Intergenic
957866594 3:86033028-86033050 TTTCCCCAAATTTCCTCTTTTGG + Intronic
958057674 3:88434099-88434121 TGCCCCCAAGTCTACATTTTAGG - Intergenic
958081514 3:88751638-88751660 TGCCTCCAGCTTTATTTTTTTGG - Intergenic
958930316 3:100200730-100200752 TTCCCTCATCTTTGATTTTTTGG - Intergenic
959278074 3:104303463-104303485 TTCCCTCCACTTCAGTTTTTTGG + Intergenic
959904626 3:111697376-111697398 ATCACCCAATTTTTCTTTTTAGG - Intronic
959939730 3:112068261-112068283 TGCCCCCAACTTTGTTCTTTTGG + Intronic
960123179 3:113968452-113968474 TTCCCCCCCCTTTTTTTTTTAGG + Intronic
960130960 3:114056063-114056085 TTCCCCCTACCTTAAATTTTAGG - Intronic
960342833 3:116496774-116496796 TGCCACCATTTTTACTTTTTGGG + Intronic
961245713 3:125451564-125451586 TTTCCCTAACTATAATTTTTAGG - Intronic
961341151 3:126220811-126220833 TTCCCTCCTCTTTAATTTTTTGG - Intergenic
962206131 3:133435610-133435632 TTCGCTTAACTTTAATTTTTCGG + Intronic
963144081 3:141974541-141974563 TACCCACATATTTACTTTTTTGG - Intronic
963790152 3:149575095-149575117 TTTCCCCATCTTTTTTTTTTGGG - Intronic
965103031 3:164327221-164327243 TTCCCCCTATTTTACTTCATAGG - Intergenic
965859323 3:173128779-173128801 TTCCCAGAAAATTACTTTTTTGG + Intronic
966342693 3:178942919-178942941 GTCCCTCTACTTTGCTTTTTTGG + Intergenic
966593516 3:181705605-181705627 TTTCCCCAACTTGTTTTTTTGGG + Intergenic
966639297 3:182171704-182171726 ACCACCCAACTTTACTTTCTTGG + Intergenic
966972331 3:185056217-185056239 TTCCCTCTACTTCAATTTTTTGG - Intergenic
969229450 4:5819691-5819713 TCCTGCCAACTTTACTTTTCTGG + Intronic
970719301 4:18967787-18967809 CTCCCCCATTTTTACTTTTGTGG - Intergenic
970983410 4:22127847-22127869 TTCCTCCAACTTTGTTCTTTTGG - Intergenic
971519656 4:27532721-27532743 ATTCCACAACTTTTCTTTTTTGG - Intergenic
971758486 4:30734040-30734062 TAACCCTAACTTTATTTTTTAGG + Intronic
973343917 4:49033578-49033600 CTCCCCATTCTTTACTTTTTGGG - Intronic
974134004 4:57791831-57791853 TTTCCCCAAATTTCCTTTTTTGG + Intergenic
975833273 4:78392659-78392681 TGCCCCCAGTTTTACTTTTTGGG + Intronic
976017851 4:80580472-80580494 TTCCTTCAACTGTAATTTTTAGG + Intronic
976271634 4:83236384-83236406 TTCCCTCCTCTTTAATTTTTTGG - Intergenic
976900233 4:90165365-90165387 TTCCCCAAACTAAACATTTTGGG - Intronic
977196938 4:94074991-94075013 TTCCCACAACTTTATCTTGTAGG + Intergenic
978137921 4:105285252-105285274 TTCTCTCACCTTTAATTTTTTGG + Intergenic
978479754 4:109175635-109175657 TTCCCAAAAATTTAATTTTTAGG + Intronic
979228725 4:118321744-118321766 TTCCCCCAACTTTACTTTTTGGG - Intronic
980041745 4:127948051-127948073 GTCCCCCAAATTTCATTTTTTGG + Intronic
981336762 4:143576914-143576936 GTGCCCCATCATTACTTTTTAGG - Intergenic
981669414 4:147270203-147270225 TTCCCTCTACTTCAATTTTTGGG + Intergenic
981733196 4:147921592-147921614 TTCCCTCAACCTCACATTTTAGG - Intronic
981761212 4:148197063-148197085 TTCTTCCAACTCTACCTTTTTGG - Intronic
982478748 4:155883181-155883203 CTCCCACATATTTACTTTTTAGG - Intronic
982488957 4:156004372-156004394 TTCCCTCCACTTCAATTTTTTGG - Intergenic
983703431 4:170627147-170627169 TTCCTGCAACTTTACTATATTGG + Intergenic
983758189 4:171368982-171369004 TTCCCCCATCTCCACTTTCTTGG + Intergenic
985348315 4:189031169-189031191 TTACGCCAACTCTATTTTTTTGG - Intergenic
985482439 5:123408-123430 TTCCCTCCTCTTTAATTTTTTGG + Intergenic
986055758 5:4135465-4135487 TTCCCCCAACTTTTATGTTTGGG - Intergenic
986223440 5:5791177-5791199 TTCCCCCTCCTTTTTTTTTTTGG - Intergenic
986504409 5:8433695-8433717 TTCTCCCAAATTTATTTTTAGGG + Intergenic
986777002 5:11025015-11025037 TTACCCCAACTTTACTGTCGAGG + Intronic
988668651 5:33357629-33357651 TGGCCCCAACTTTACATTTTAGG + Intergenic
989662997 5:43819866-43819888 TTTTCCCAACTTTAATTGTTTGG + Intergenic
990077632 5:51870936-51870958 TCCCCCCAACCTTTCTGTTTTGG + Intergenic
990826879 5:59910077-59910099 TTCCTCGATCTTTCCTTTTTGGG + Intronic
991581964 5:68165094-68165116 TTTCCCCATTTTTACTTCTTTGG + Intergenic
992282183 5:75190440-75190462 TTTCCTCATCTTTAATTTTTTGG + Intronic
992487538 5:77210716-77210738 TCACCCCAACTTTCCCTTTTGGG - Intronic
993280223 5:85916489-85916511 TCCCCCAAAATTTACATTTTAGG - Intergenic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
994704082 5:103178236-103178258 TTCACCAAAATTGACTTTTTTGG + Intronic
995677994 5:114684965-114684987 GCCTCCCAACTTTCCTTTTTTGG - Intergenic
996172278 5:120308815-120308837 TTCCCTGAAATTTTCTTTTTTGG + Intergenic
997536737 5:134628368-134628390 TTCTCCCAATAGTACTTTTTGGG - Intronic
997643617 5:135466003-135466025 TTCCCCCAAATTCTCTTTATTGG - Intergenic
997752912 5:136365965-136365987 ATCTTCCAACTTTACTATTTTGG + Intronic
999999771 5:157126594-157126616 TTCCCTCTGCTTTAATTTTTAGG - Intronic
1003492117 6:6632173-6632195 TTGCCCCAAATCTAATTTTTTGG - Intronic
1003723586 6:8733701-8733723 TTCCCCAGATTTTGCTTTTTTGG - Intergenic
1003929465 6:10909686-10909708 TACGGCCAACTTTCCTTTTTGGG - Intronic
1006095294 6:31652498-31652520 GTCCCCAAGCTTTACTTTTGTGG + Exonic
1006255857 6:32831515-32831537 TTCCAGCAACAGTACTTTTTAGG - Intronic
1006558340 6:34888307-34888329 GTCCCCCAACTTTACTCTGAGGG - Intergenic
1007578564 6:42941482-42941504 TTTCCCCTACCTTTCTTTTTTGG + Intergenic
1008117118 6:47564641-47564663 TTTCCCCAACTCTAAATTTTAGG + Intronic
1008818980 6:55608510-55608532 TTCCCCCAAAATTAATTTTAGGG + Intergenic
1008866909 6:56223119-56223141 TTCTTCCAACATTACTTTCTGGG + Intronic
1009198396 6:60714661-60714683 TTCCACTAACTTTTGTTTTTTGG - Intergenic
1009285485 6:61811102-61811124 TTCCCCCTCCTTCCCTTTTTTGG + Intronic
1009328453 6:62383877-62383899 TGCCTCCAACTTTATTCTTTTGG + Intergenic
1009483230 6:64187142-64187164 TTCCCCAAGTTTTACATTTTTGG + Intronic
1009759467 6:67984947-67984969 TTCCCCCAAACTTTCTTTGTAGG - Intergenic
1011351989 6:86433553-86433575 TTCCCCCTCCTATACTGTTTAGG + Intergenic
1012350490 6:98244276-98244298 CTCTCCTAATTTTACTTTTTTGG - Intergenic
1012945218 6:105458664-105458686 TTCCCTCAACTTCACTTTAATGG - Intergenic
1013526371 6:110977802-110977824 TTCCCTCCTCTTTAGTTTTTTGG - Intergenic
1013996027 6:116309225-116309247 TACACACAACTCTACTTTTTAGG + Intronic
1014079284 6:117269286-117269308 TTCCCCCACCTTTGTTTTGTTGG - Intronic
1015005603 6:128277636-128277658 TTCCCCAACCTTCACTTCTTTGG - Intronic
1015655079 6:135508842-135508864 TTCCCTCAGCTTCAATTTTTTGG + Intergenic
1015887804 6:137937527-137937549 TTCCCTCCTCTTTAATTTTTTGG + Intergenic
1016141556 6:140618062-140618084 TGCACCCAGCTTCACTTTTTTGG + Intergenic
1016724708 6:147349515-147349537 TTCCCCAAACATTTCTTTTTTGG - Intronic
1017785094 6:157749853-157749875 TTTCCCCTAATTTCCTTTTTTGG - Intronic
1017940730 6:159050621-159050643 TTCCACCATTTCTACTTTTTTGG - Intergenic
1018018671 6:159736236-159736258 TTTCCGCAACTTTTTTTTTTAGG + Exonic
1018114370 6:160569186-160569208 TGCCTCCAGCTTTGCTTTTTTGG - Intronic
1020782090 7:12530343-12530365 TACCCCCAAATATACTTTTTTGG - Intergenic
1022779323 7:33562480-33562502 TTCCCCCAAATTTAATTAATTGG + Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024817075 7:53283782-53283804 TGCCTCCAGCTTTACTCTTTTGG + Intergenic
1024840297 7:53577804-53577826 TGCCTCCAGATTTACTTTTTTGG - Intergenic
1027620698 7:80481548-80481570 TACCCCCAAATATATTTTTTTGG + Intronic
1027912065 7:84263121-84263143 TTCCCTCAATATTATTTTTTGGG + Intronic
1028446588 7:90931384-90931406 TTCCAGAAACTTTACTTCTTTGG - Intronic
1029220321 7:98983563-98983585 TTCCCCCAGGTTTTCTATTTTGG + Intronic
1032728747 7:134616618-134616640 TGCCTCCAATTTTACTTCTTTGG - Intergenic
1032956441 7:136977310-136977332 TTCCCCTAACTTCTCTTCTTAGG + Intronic
1033426402 7:141248427-141248449 TATCCCCATCTTTATTTTTTGGG - Intronic
1033874608 7:145799275-145799297 TTTCCCCAACTTTAATTTCAAGG - Intergenic
1034156898 7:148963491-148963513 GTCCCCCTCCTTTTCTTTTTAGG + Intergenic
1037083828 8:14821426-14821448 TTCCCTCATCTTTAGTTTTCTGG - Intronic
1037467818 8:19177215-19177237 TTCCACCTACTTAATTTTTTAGG + Intergenic
1037624898 8:20598076-20598098 TTCCCTCACCTTTACTATTTTGG - Intergenic
1037958337 8:23076086-23076108 TTTCCCCAACTTTATATTTCTGG - Intergenic
1039562930 8:38527619-38527641 ATGCCCCAACTTTGCCTTTTGGG + Intronic
1039934298 8:42027317-42027339 TTCCCTCCTCTTTAATTTTTTGG + Intronic
1040620805 8:49090583-49090605 TTCCCCCAGCTTTCCTTTTCAGG + Intergenic
1041255057 8:55972798-55972820 TTCCCCCCACTTTACTATTTAGG + Intronic
1041883506 8:62780394-62780416 TTCCCTCCTCTTTAATTTTTAGG - Intronic
1043013663 8:74911182-74911204 TTACCCCAACTTTTCTTTTGCGG - Intergenic
1043729343 8:83654916-83654938 ATCACCTAAATTTACTTTTTGGG - Intergenic
1043855193 8:85257156-85257178 TTCCACAAACTTTAGTTTGTAGG - Intronic
1045127535 8:99108893-99108915 TTCCCTCCACTTCAATTTTTTGG + Intronic
1045134359 8:99197871-99197893 TTTCCCCAAGATTTCTTTTTGGG + Intronic
1045196008 8:99931236-99931258 TTCCCCCATCTTCAGTTTTTTGG - Intergenic
1045196135 8:99932652-99932674 TTCCCCCAATTTCAGTTTTTTGG + Intergenic
1046332648 8:112740678-112740700 TTCACCAAACTTTTCTTTCTTGG - Intronic
1048907227 8:139099867-139099889 TCACCCCAAATCTACTTTTTAGG - Intergenic
1049739492 8:144230673-144230695 TTCCCTCCTCTTTAATTTTTTGG + Intronic
1050634390 9:7595815-7595837 TTCCACCAGCTTTGCTCTTTTGG - Intergenic
1050816079 9:9813635-9813657 TGCCCCAGACTTTTCTTTTTGGG - Intronic
1051001011 9:12281500-12281522 TTGCCCCACCTTTATATTTTTGG - Intergenic
1052779952 9:32771336-32771358 TTCCCTCCTCTTCACTTTTTTGG - Intergenic
1054947230 9:70808510-70808532 TTCCCTCAAAGTTATTTTTTTGG + Intronic
1055456034 9:76472378-76472400 TTCACTCAATTCTACTTTTTTGG - Intronic
1057411736 9:94822368-94822390 TTCCTTAAACTTTTCTTTTTAGG - Intronic
1057458869 9:95240968-95240990 TTCCCTAAACTTAACTTTGTGGG + Intronic
1057950756 9:99367518-99367540 CTCCCCCATTGTTACTTTTTCGG - Intergenic
1058416300 9:104792366-104792388 ATCTCCAAATTTTACTTTTTTGG - Intronic
1060566287 9:124595085-124595107 TTTCCACAACTTTATTATTTAGG - Intronic
1187655128 X:21463453-21463475 TGTCCCCAGCTTTCCTTTTTGGG + Intronic
1188733723 X:33685105-33685127 TTCCCCCTTCTCTATTTTTTTGG + Intergenic
1188889273 X:35589673-35589695 TTTGCTCAACTTTAATTTTTTGG + Intergenic
1189001791 X:36955910-36955932 TTCCTCAAAATATACTTTTTTGG + Intergenic
1190223796 X:48530353-48530375 TGCCCCCCACTTTTTTTTTTGGG - Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1193577020 X:83212068-83212090 TTCCTCCAACTTTGTTCTTTTGG - Intergenic
1194394791 X:93369240-93369262 TTCCCTCCTCTTTAATTTTTGGG + Intergenic
1194583161 X:95701112-95701134 TTTCCCCCACTTTATGTTTTTGG + Intergenic
1194845733 X:98806409-98806431 TTGCACCTACTTTTCTTTTTAGG + Intergenic
1195281154 X:103334307-103334329 ATACCCCCATTTTACTTTTTAGG - Intergenic
1195302676 X:103546350-103546372 TTCCCTCCTCTTTAATTTTTGGG - Intergenic
1195579464 X:106484870-106484892 TTCCCCTTAATTTACTATTTGGG + Intergenic
1196171655 X:112594826-112594848 TGCCTCCAACTTTATTCTTTTGG - Intergenic
1196370016 X:114967195-114967217 TTCCCCCAACATTCTATTTTTGG - Intergenic
1197866228 X:131021168-131021190 TTCCCTCATCTTTACATTTCTGG + Intergenic
1198892119 X:141409138-141409160 TTCCCTCAACTTTACAGTGTTGG - Intergenic
1200113126 X:153753801-153753823 TTCCCTCCTCTTTAGTTTTTTGG - Intergenic
1201350098 Y:13030421-13030443 TGCCTCCAACTTTATTCTTTTGG - Intergenic
1201699380 Y:16863464-16863486 TGCCTCCAACTTTGCTCTTTTGG - Intergenic