ID: 979230478

View in Genome Browser
Species Human (GRCh38)
Location 4:118343437-118343459
Sequence TTTCCTTCACATATGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979230478_979230480 -8 Left 979230478 4:118343437-118343459 CCATATTCCATATGTGAAGGAAA 0: 1
1: 0
2: 2
3: 23
4: 257
Right 979230480 4:118343452-118343474 GAAGGAAACCTAAAAGAAATAGG 0: 1
1: 1
2: 3
3: 45
4: 634
979230478_979230482 0 Left 979230478 4:118343437-118343459 CCATATTCCATATGTGAAGGAAA 0: 1
1: 0
2: 2
3: 23
4: 257
Right 979230482 4:118343460-118343482 CCTAAAAGAAATAGGAGAAAAGG 0: 1
1: 0
2: 4
3: 56
4: 715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979230478 Original CRISPR TTTCCTTCACATATGGAATA TGG (reversed) Intronic
904958287 1:34307127-34307149 TTTCCTTGACATATAGGAGAAGG + Intergenic
906479885 1:46193053-46193075 CATCCTTCACATCTGGAAAATGG - Intronic
907713777 1:56908895-56908917 TTTCCTCCACAGAGGAAATATGG + Intronic
908057096 1:60299384-60299406 TTCCCTTTACATTTGGAAAAAGG - Intergenic
909848122 1:80423182-80423204 CTTCCCTCCCATATGGTATAGGG + Intergenic
910864605 1:91776789-91776811 TTTCCTTCACCTTTGGGATTTGG + Intronic
917950603 1:180029162-180029184 TTGCTTTAAGATATGGAATATGG + Intronic
918119189 1:181522786-181522808 GATCCTTCACATATGGACTCTGG + Intronic
919865721 1:201781487-201781509 TTTCCTCCACATTTGTAAAATGG - Intronic
920332914 1:205224194-205224216 TTACTTAAACATATGGAATATGG + Intergenic
920332979 1:205225091-205225113 TCTCTTTCTCATATGGTATATGG + Intergenic
921171671 1:212555415-212555437 TTTCCATCACACTTTGAATAAGG + Intergenic
921754139 1:218833794-218833816 TTTCCTTCACTTGGGGAACATGG - Intergenic
922206821 1:223455345-223455367 TTTCCTTCACTTAGGGAGGAAGG - Intergenic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
923134488 1:231105984-231106006 TTCTCTTAACATTTGGAATAAGG + Intergenic
923414881 1:233746996-233747018 TTTCCTGCTCGTATGGAATAGGG + Intergenic
923900077 1:238316320-238316342 TTTTCTTCACATTTAAAATAAGG + Intergenic
924105283 1:240643324-240643346 TTTCCTTCATATTCTGAATAAGG + Intergenic
924320735 1:242846496-242846518 TTTCCTACTGATATGTAATATGG - Intergenic
924386179 1:243499558-243499580 AGCCCTTCACATATGAAATAAGG - Intronic
924478579 1:244405138-244405160 TTTCAATTACATATGAAATAGGG + Intergenic
1064301959 10:14130783-14130805 TTTATTTGACATAGGGAATAAGG + Intronic
1067330215 10:45308870-45308892 TTTCCTTCCCATATTTAAGATGG + Intronic
1068065309 10:52122859-52122881 ATTCATTCAAATGTGGAATATGG + Intronic
1068080410 10:52312417-52312439 TTTCCTGGACAGATGGAATTTGG + Intergenic
1068128513 10:52869232-52869254 GTTACTTCACATATAGAATGGGG - Intergenic
1068382794 10:56279736-56279758 TTTTCTTCATAGATGCAATAAGG + Intergenic
1068613468 10:59086415-59086437 TGCCCTTCATATATGGAATTTGG + Intergenic
1068824061 10:61413130-61413152 TTTCTTTCACCCATGAAATAGGG - Intronic
1068825409 10:61432835-61432857 GCTCCTACAGATATGGAATATGG - Intronic
1069441266 10:68430256-68430278 TTTCCTTCTGATCTGAAATAAGG - Intronic
1070311663 10:75277804-75277826 TTCCCTTAAGATATGGAATCAGG - Intergenic
1074653300 10:115550817-115550839 CTTCCTTCCCTAATGGAATAAGG + Intronic
1075186118 10:120259429-120259451 CTTTCTTCACATAAGCAATAAGG + Intergenic
1078116545 11:8458042-8458064 TTTTTTTCCCATATGCAATAAGG + Intronic
1078476958 11:11638794-11638816 TTTTCTTCATTTATGAAATAAGG + Intergenic
1078489251 11:11754154-11754176 TTTCTCTCCCAGATGGAATATGG + Intergenic
1079334449 11:19559008-19559030 TTGCTTTGACTTATGGAATATGG - Intronic
1079923349 11:26459528-26459550 TCTCCTTAACATCTAGAATAGGG - Intronic
1080765772 11:35295602-35295624 TGTCCTTCTCATGTGGAAAATGG - Intronic
1085964593 11:81506542-81506564 TTTCCTTCTCATATGAGAAAGGG - Intergenic
1087290211 11:96313121-96313143 TTTCCTTCACATGTGCAAGAGGG - Intronic
1087340583 11:96901069-96901091 TTTTTTTCACATGTGGGATAAGG + Intergenic
1087510546 11:99086952-99086974 TTTTCTTCATCTATGAAATAGGG - Intronic
1088157589 11:106827521-106827543 TTTCCTTCACATATCAACTTTGG + Intronic
1088574743 11:111259615-111259637 TTCCCTTTAAATATGGAATGTGG - Intronic
1088694888 11:112358231-112358253 TTTCTTTCACATACAGAAAAGGG - Intergenic
1090213963 11:124943932-124943954 TTTCCTTCACATTTGCAAGTTGG + Intergenic
1091192123 11:133704857-133704879 TTTTCTTCATCTATGGAACAGGG - Intergenic
1092675909 12:10919211-10919233 TTTTCTTCACATATTTAAGATGG + Intronic
1092681307 12:10984266-10984288 TTCCCATCACACATCGAATATGG + Intronic
1092854798 12:12663016-12663038 TTTCCATCACAGAAGGATTATGG + Intronic
1093634572 12:21449629-21449651 TTTCCTTCACATATCAACTTTGG - Exonic
1094789358 12:33893390-33893412 TTGCCTTCCCATATGAAATTTGG - Intergenic
1095338880 12:41064823-41064845 TTTCCTTCAACTATAAAATAGGG - Intronic
1095840575 12:46687359-46687381 CTTCTTTCACATAGGGAAGACGG + Intergenic
1098564247 12:71913857-71913879 TTTCCATCACATATAAAAGAGGG - Exonic
1098611918 12:72469088-72469110 ATTCCCTCACCTATGAAATAAGG - Intronic
1099207217 12:79742583-79742605 TTTCCTTCACATCTGAATTTGGG - Intergenic
1099417069 12:82403516-82403538 ATTCCTTCAGATATGAAAAAAGG - Intronic
1100384893 12:94096627-94096649 TTTCCTCCACATGTGGATTTTGG - Intergenic
1100908823 12:99334780-99334802 CTTCCTTTACGTATGGAGTAAGG + Intronic
1101256594 12:102983785-102983807 TTTCATTCAGAAATGGAAAATGG - Intergenic
1101696440 12:107131746-107131768 TTTTTTACAAATATGGAATAAGG + Intergenic
1105674798 13:22659420-22659442 TTTCCTTCACATTTAAAATTGGG + Intergenic
1105849264 13:24319873-24319895 GTTCCCTCACATATGGAACTAGG - Intronic
1107186889 13:37533181-37533203 TTTTCTTCAGAAATGGAATATGG + Intergenic
1107339135 13:39387586-39387608 TTTCCTTCACCTATTAAACAGGG - Intronic
1109213628 13:59563302-59563324 TTTCTTTCACAGATGGGAGATGG - Intergenic
1110188154 13:72699300-72699322 TTCCCTGAACATATGGAATGTGG + Intergenic
1110235255 13:73211245-73211267 TTTTCTTTACAAATGGAAGATGG + Intergenic
1110572216 13:77017668-77017690 TTTTCTTCACATATAAAATAAGG - Intronic
1111614474 13:90645164-90645186 TTTCCTTCATAGCTGGAAAATGG - Intergenic
1111936541 13:94563607-94563629 TTTTCTTCACATTAGCAATAGGG + Intergenic
1111989983 13:95106868-95106890 TCTCTTTCACACATGAAATAAGG + Intronic
1114403792 14:22435098-22435120 TCTCCATCACATATGGAGGAAGG + Intergenic
1114516751 14:23305224-23305246 TTGCCTTCACATAGTCAATATGG - Intronic
1114704262 14:24709586-24709608 TAGCCTTCAGATATTGAATATGG - Intergenic
1114798828 14:25747711-25747733 CTTCATTCACATTTGGACTATGG + Intergenic
1114919988 14:27313938-27313960 TTTCCTTTACATATTGTCTATGG - Intergenic
1115780696 14:36765044-36765066 TTTCCTTGACCAATAGAATATGG + Intronic
1121022341 14:90587904-90587926 GTTTCTTCACCTATGGAATGGGG + Intronic
1121642829 14:95497283-95497305 TTGCCTTCTCATCTGTAATATGG + Intergenic
1125532245 15:40421246-40421268 TTTGCTTCACATATAGAACCAGG - Intronic
1126965277 15:54044978-54045000 TTTAAATCACATATGGCATAAGG - Intronic
1127094595 15:55499703-55499725 TTTGCTACAAATCTGGAATAGGG + Intronic
1128145019 15:65328229-65328251 TTTCTTTCACATCTGGAAATGGG + Exonic
1129641445 15:77382758-77382780 TTTTATGCACATTTGGAATATGG + Intronic
1130055300 15:80518754-80518776 TATCCTTCCCATATGGCCTAAGG - Intronic
1130060741 15:80568131-80568153 GTTCCATCAAATATGGAATGAGG + Intronic
1131132133 15:89907000-89907022 TTTCCTCCACTGATGGAGTATGG + Intronic
1131520482 15:93110458-93110480 TTTCCCTCACATAAGGTAGAGGG - Intergenic
1136254995 16:29032610-29032632 TTTCATTCACATATTGCTTAGGG + Intergenic
1137853365 16:51768352-51768374 GTTCCTTTACATATGGTCTACGG - Intergenic
1138752017 16:59434184-59434206 TTTCTTTCAGATCTGGAATACGG - Intergenic
1138833428 16:60403933-60403955 TTTCCTTTATATATTAAATAAGG + Intergenic
1140343806 16:74192568-74192590 TTTCCTACACATGTGACATATGG - Intergenic
1140819522 16:78649857-78649879 TGTCTTCCACATATGGTATAAGG + Intronic
1143352081 17:6296360-6296382 TTTCCTTCCCCTATGAAATGGGG - Intergenic
1144062434 17:11595825-11595847 ATTCCCTCTCATATTGAATAGGG + Intergenic
1153612260 18:6898462-6898484 TTTCCTTCCTAAATGGAAAATGG + Intronic
1153683063 18:7518915-7518937 TTTCCTTCACATAATGACTTTGG + Intergenic
1154404166 18:14073035-14073057 TTTCCTCCAAATATGGATTTAGG - Intronic
1156818404 18:41340382-41340404 TTCACTTCACATATTGAATTAGG + Intergenic
1162096601 19:8313609-8313631 GTTTCTTCACATATAAAATAGGG - Intronic
1164872436 19:31657094-31657116 GTTCATTCATCTATGGAATAAGG - Intergenic
925564981 2:5241634-5241656 TTTCCTTCAAAAATGGAAAAGGG - Intergenic
925639203 2:5971281-5971303 ATTCCTTCACAGCTGGAATGTGG + Intergenic
925871419 2:8274758-8274780 TTTCCTTTGCATTTGGAACATGG + Intergenic
927629627 2:24761516-24761538 TTTCTTAAACAAATGGAATATGG + Intronic
928645436 2:33347356-33347378 ATTCATTCACATCTGGAAAAGGG - Exonic
928805741 2:35151900-35151922 TTTACTTGACATATGTCATATGG + Intergenic
929727966 2:44451903-44451925 TTTTTTTCAAAAATGGAATAAGG - Intronic
933488818 2:82958654-82958676 TTTCTTTTTCATATGGAATTTGG - Intergenic
933573824 2:84044221-84044243 GTTTCTTCTCCTATGGAATAAGG - Intergenic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
937351253 2:121164086-121164108 GTACCTACACATATGGAAAATGG - Intergenic
939534755 2:143414079-143414101 TTTCCTAAATATATGCAATAAGG - Intronic
939697076 2:145339928-145339950 TTTCTGTCACAGAGGGAATACGG - Intergenic
939699782 2:145376271-145376293 TCTCCTTCACATATGAAAGCAGG - Intergenic
941862382 2:170297070-170297092 TCTCCTTCACATATTGAATAAGG + Intronic
942345278 2:174996496-174996518 ATTCCTGCACAGATGGGATAAGG + Intronic
943541027 2:189214244-189214266 TTTCCTGGACATAAAGAATAAGG - Intergenic
944201643 2:197113880-197113902 TTTTCTTCACATAGGGAAACAGG + Intronic
945501422 2:210580445-210580467 TTTCTTTCAGATTTGGAATATGG - Intronic
945876288 2:215281531-215281553 TTTCCTTCCCATATTCAGTAAGG + Intergenic
946957787 2:224950847-224950869 GTTCCTTTACATATGGTAGATGG + Intronic
947231379 2:227891054-227891076 TTTCTTTTACATATGGCATGTGG - Intronic
1169008515 20:2230047-2230069 TTTTCCTCACCTATGAAATAGGG - Intergenic
1169787584 20:9376668-9376690 TTTGCTTCTCATTAGGAATAGGG - Intronic
1169821752 20:9719071-9719093 TTCCCTTCACTGTTGGAATAAGG + Intronic
1169880877 20:10344685-10344707 TGTCCTTCATATATGGCATAGGG + Intergenic
1173129229 20:40372161-40372183 TTACCTTCAGAGATGGAATTTGG - Intergenic
1174127712 20:48319475-48319497 TTTACTTCCCATGTGGAATGGGG - Intergenic
1174140891 20:48412872-48412894 ATTCCTTCACATTTAGAAGATGG - Intergenic
1177473520 21:21589325-21589347 TTCCCTTAAAATAAGGAATAAGG + Intergenic
1179263051 21:39775564-39775586 TTTTCTTCACAGATGGGAAAAGG + Intronic
1179335101 21:40444009-40444031 TTTCCTTAAGACAAGGAATAAGG + Intronic
1179360037 21:40697130-40697152 TTTCACTCACATATGGGATCTGG - Intronic
1181784907 22:25220042-25220064 TTTCCTCCACATCTGCAATTAGG + Intronic
1182746504 22:32609952-32609974 TTTCCTTCACATTTCTAAAAGGG - Intronic
949092349 3:43296-43318 ATTCATACACATATGGAAGATGG - Intergenic
951837901 3:27002960-27002982 TTCCCTTGACATAAGGGATATGG - Intergenic
952053534 3:29415641-29415663 TTCACTTCACATATGGATTAAGG - Intronic
953542881 3:43837897-43837919 TTTCCTTTAAATGTGGAAGAGGG - Intergenic
955616122 3:60808628-60808650 TTTCCTTTACAGCTGGAAAAGGG + Intronic
956742075 3:72282960-72282982 CTGCTTTCACAAATGGAATATGG + Intergenic
958064577 3:88527245-88527267 TCTCCTTCACTTATGAAATTTGG + Intergenic
958262396 3:91396925-91396947 TTTCTTTCACCTTTGAAATATGG - Intergenic
958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG + Intergenic
958872686 3:99579662-99579684 ATTCCATAACATATGGCATAAGG + Intergenic
958936107 3:100257629-100257651 GTTCCTTCCCACATTGAATAAGG + Intergenic
959166668 3:102788557-102788579 TTTCCTATACAAATGGCATAAGG + Intergenic
960562035 3:119095044-119095066 TTTCCTGAACTTTTGGAATAGGG - Intronic
963334182 3:143953536-143953558 TTCCCATCACATCTGGAATATGG - Intergenic
965273166 3:166645280-166645302 TCAACTTCACATATAGAATATGG + Intergenic
969218334 4:5741396-5741418 TTTTCTTCACACATGGAAATGGG + Intronic
970061883 4:12042663-12042685 TCTCCTTCGAATATGAAATATGG - Intergenic
970689695 4:18608354-18608376 GTTCCTTCACACATGGAAACTGG - Intergenic
971733925 4:30421051-30421073 TTTCCTTCACACATGGTTTTGGG - Intergenic
971872317 4:32258597-32258619 TTTAATTCACATTTGGAACATGG + Intergenic
972119660 4:35684226-35684248 TTTCTTTGACAAATGGAATATGG + Intergenic
972145207 4:36015586-36015608 GATTCTTCACATATGGTATATGG + Intronic
972529929 4:39952365-39952387 TTTCCTTTACATATGTAAGAAGG + Intronic
972576647 4:40358028-40358050 TTTTCTTCCCATTTGGAATGTGG - Intergenic
973215471 4:47664374-47664396 GTTCCTTTACATGTAGAATAAGG - Intronic
974718633 4:65706165-65706187 ATTCATTCACATATGGTCTATGG - Intergenic
974765498 4:66339570-66339592 TGTCCTTTACTTATTGAATAAGG - Intergenic
975217375 4:71770947-71770969 TGTCCATCACATATGTAATAGGG + Intronic
975855322 4:78618176-78618198 TTTCCTTCACATCTAGGAAAGGG - Intergenic
976204828 4:82614836-82614858 TCTCCCTCAAACATGGAATAAGG - Intergenic
977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG + Intronic
978312363 4:107398621-107398643 TTACCTTGCAATATGGAATAAGG + Intergenic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
979837887 4:125396015-125396037 TTTCATTCACATCTGGAATCTGG - Intronic
981516989 4:145620047-145620069 TTTTCTAAACATATGGATTAGGG - Intronic
982263749 4:153519545-153519567 TTGCCATCACATATAGAATGTGG + Intronic
983717442 4:170801695-170801717 TGTCCTTCAAATATGAAAAAAGG + Intergenic
983805770 4:171989408-171989430 GTTCCTACACAGATGGGATACGG + Intronic
984040542 4:174727334-174727356 TTTCCTTCTCATCAGGAATGGGG - Intronic
984575188 4:181439337-181439359 TGTCCTACACTCATGGAATATGG + Intergenic
984672236 4:182503743-182503765 TTGTCTTGACCTATGGAATATGG - Intronic
984934412 4:184877810-184877832 TGTGCTTCACATATGCAAAATGG - Intergenic
986165052 5:5265822-5265844 TTGCCTTGACATATGGAAGTTGG + Intronic
986470085 5:8064905-8064927 TTTCCCTCACACATAGAATCAGG - Intergenic
986622630 5:9691564-9691586 TTTCCTTACGATATGAAATAAGG - Intronic
988019435 5:25605007-25605029 TTTCCTTCCAATATGGATTTAGG - Intergenic
989090918 5:37729999-37730021 TACCCTTCACATAGGAAATACGG - Intronic
989384532 5:40841785-40841807 TTTCATTGAAATATGAAATAGGG + Intronic
990370783 5:55116010-55116032 TTTCCCTCACCTATAAAATAAGG - Intronic
990384613 5:55247742-55247764 TTTGCTTTACATTTGGAACAGGG - Intergenic
992311383 5:75503512-75503534 TTTCCTTTAAATATGTAACATGG + Intronic
993028667 5:82676846-82676868 TTTCTTTCTCATATTGAAAATGG - Intergenic
993812655 5:92501674-92501696 TTCCCTTCACAAATGGAAAAAGG - Intergenic
994165683 5:96605999-96606021 TTTCCCTCAAATATCAAATATGG + Intronic
994854904 5:105106287-105106309 TTTCCTTGACAGATCGTATAAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996310395 5:122097928-122097950 TTTCCTTCACATATACAAAAGGG - Intergenic
997236808 5:132276983-132277005 TTCTCTTCATATATGGAATCTGG + Intronic
999848417 5:155510848-155510870 CTTCCTTCTGATCTGGAATATGG + Intergenic
999882157 5:155877471-155877493 TTTTCCTCACATATTGAATGAGG + Intronic
999985623 5:157002385-157002407 ATTTCTTCACCTATGGAATCTGG + Intergenic
1000474238 5:161685771-161685793 TTTCCTTCTCACGTGGAACAAGG - Exonic
1004161746 6:13220288-13220310 TTTTCTTGACAAATGTAATAGGG - Intronic
1004853266 6:19722880-19722902 TTTCTTTGACATTTGAAATAAGG - Intergenic
1006181593 6:32156570-32156592 ATTCATTCACATATGGTACATGG - Intronic
1008142508 6:47847970-47847992 TTTCCTTAACATATATAAAATGG + Intergenic
1008246441 6:49179705-49179727 TTTTCCTCATATATGGAACATGG - Intergenic
1008993021 6:57625952-57625974 TTTCTTTCACCTTTGAAATATGG + Intronic
1009181635 6:60525057-60525079 TTTCTTTCACCTTTGAAATATGG + Intergenic
1009458235 6:63881721-63881743 TTTCCATTACTTATAGAATAGGG + Intronic
1009588130 6:65632822-65632844 ATTTCTTCACCTATGGAACATGG - Intronic
1009798290 6:68500963-68500985 TATCTTTCCAATATGGAATATGG + Intergenic
1010386618 6:75287751-75287773 TTTCATTCACATCTGTAACAAGG + Intergenic
1011369278 6:86615695-86615717 GGTCCTACACATATGGATTAAGG - Intergenic
1012896986 6:104960338-104960360 TGTGCATCACTTATGGAATAAGG + Intronic
1013928255 6:115499234-115499256 TTGCTTTCCAATATGGAATAAGG + Intergenic
1014129740 6:117817116-117817138 TATCTTTCAAATATGGAAAAAGG + Intergenic
1015011077 6:128349016-128349038 TTGCCTTCTTATGTGGAATAAGG - Intronic
1015123557 6:129727529-129727551 TTTCCTTCACAGGTGATATAGGG - Intergenic
1015356526 6:132283353-132283375 TGTCTTTAACATATGAAATATGG - Intergenic
1016319330 6:142825143-142825165 TTTCCTAGACATCTGGATTAAGG + Intronic
1018231547 6:161680480-161680502 TGCCCTTCACGGATGGAATAAGG + Intronic
1018284232 6:162219770-162219792 GTTTCTTTACATATGAAATAGGG + Intronic
1019096964 6:169589797-169589819 TTTCTTTCACACATGGATTGTGG - Intronic
1019678380 7:2329637-2329659 TTTCCTTCCCCCAGGGAATAGGG - Intronic
1020972782 7:14967192-14967214 TCTCCAGCACATATGGATTAAGG - Intronic
1021285866 7:18780200-18780222 GTTCCTTCACCTATGAAGTAAGG + Intronic
1021445559 7:20730170-20730192 TTTCCTTATAAAATGGAATATGG + Intronic
1021842348 7:24731144-24731166 TTTGCTTCCCATAGAGAATATGG + Intronic
1022703898 7:32785633-32785655 TTTCCTTCCCAAATAGAATCGGG - Intergenic
1022976543 7:35562939-35562961 TTTCCTTCACAGTTGGAAGATGG - Intergenic
1023286783 7:38629635-38629657 ATTCCTTCACAGATGGAAAGTGG + Intronic
1023389752 7:39698239-39698261 TTGCCATCACATAAGGAATTCGG + Intronic
1027806111 7:82825114-82825136 TTTAGTTCACATTTGAAATAGGG + Intronic
1028126669 7:87120630-87120652 CTTCCTTCACATAAGGACTAAGG - Intergenic
1030760136 7:113340366-113340388 TTTCCTTCTAATAGGGACTAAGG + Intergenic
1032333677 7:131004507-131004529 TTTCCCACAGATATGGAAAAGGG - Intergenic
1033353663 7:140582529-140582551 TTCTCTTCTCATATGGAAAAGGG - Intronic
1033819716 7:145120227-145120249 TTTCCTTCTGATTTGGAATTTGG + Intergenic
1034085640 7:148320049-148320071 TTTCCTTTTCATATGGAGAAGGG + Intronic
1034350244 7:150410598-150410620 TTTCATTCACATCTGGAAGAAGG - Intronic
1036640771 8:10582146-10582168 TTACTTTCACATGTGAAATATGG - Intergenic
1038232016 8:25709825-25709847 TTTTTTTCAGATATGTAATATGG + Intergenic
1040545335 8:48394476-48394498 TTTCCCTCACCTGTGGAATGGGG + Intergenic
1041082542 8:54227174-54227196 CTTCCTCCACCTATGGAATAGGG - Intergenic
1041569393 8:59320184-59320206 TTTCCTTCACATTTGTTTTAAGG + Intergenic
1043219010 8:77635031-77635053 TTTGCTTCACCCTTGGAATATGG + Intergenic
1044763176 8:95544220-95544242 CTTCTTTTGCATATGGAATAGGG + Intergenic
1045625257 8:104039082-104039104 TTTCATTCTTATAAGGAATATGG - Intronic
1047371078 8:124256561-124256583 TTTCCTTGAGCTATGGAAAAAGG - Intergenic
1047990396 8:130280237-130280259 TTTACTTCTCATATGGAGTATGG + Intronic
1052729027 9:32263861-32263883 TTCCCTTCACTTATGAAAAAGGG - Intergenic
1052907593 9:33849902-33849924 TTTCCTATACATATAGAATTGGG - Intronic
1053696712 9:40645847-40645869 TTTCTTTCAGATATGGCAGAGGG - Intergenic
1053836244 9:42138301-42138323 TTTTATTCACCTATGGAACATGG + Intergenic
1054126858 9:61321660-61321682 TTTTATTCACCTATGGAACATGG - Intergenic
1054307963 9:63445078-63445100 TTTCTTTCAGATATGGCAGAGGG - Intergenic
1054594374 9:67050222-67050244 TTTTATTCACCTATGGAACATGG - Intergenic
1055918243 9:81430198-81430220 TTTCCTTGACATTTTGAAGAAGG - Intergenic
1056328869 9:85505244-85505266 TTTTCTTCACATATTTAAAAAGG + Intergenic
1057930956 9:99192527-99192549 TTCCCATCACATATGGATTTAGG + Intergenic
1058104033 9:100949885-100949907 TTTCCTTCACATAAGGAGTCTGG - Intergenic
1058171376 9:101685186-101685208 TTTCCCTTACATATGGCATTTGG + Intronic
1058283345 9:103145495-103145517 TTTCCTTTACAAATGGAGAATGG + Intergenic
1059257856 9:112947140-112947162 TTTCTTTCACATCTGTAAAATGG - Intergenic
1186293409 X:8123395-8123417 TGACCTACACATATGGAACATGG - Intergenic
1186763273 X:12745390-12745412 TTTCTTTCACAGAAGGAAGAAGG - Intergenic
1187256163 X:17644523-17644545 TTTCCTTTACATATAGGCTATGG - Intronic
1188394282 X:29661427-29661449 TATCCTTCACTTACTGAATAGGG - Intronic
1188437704 X:30180919-30180941 TTTCTTAAATATATGGAATATGG - Intergenic
1188902421 X:35750395-35750417 GTTCCCTGACATGTGGAATAAGG - Intergenic
1189599135 X:42602904-42602926 TTTCCTTGGCCTATGAAATAAGG + Intergenic
1194795284 X:98203699-98203721 TTTCCTTCATATTTTGGATATGG - Intergenic
1195105846 X:101600773-101600795 TTTGCGTTACATATGGAATGGGG - Intergenic
1195107037 X:101612994-101613016 TTTGCGTTACATATGGAATGGGG + Intergenic
1195938094 X:110144233-110144255 TTTTTTTCTCATCTGGAATATGG + Intronic
1196018467 X:110964711-110964733 TTTCCCTCACAAATGAAAAATGG + Intronic
1197062920 X:122202995-122203017 TTTCCTTCTGAAATGGAAAATGG + Intergenic
1199483067 X:148319333-148319355 TTACCTTCAAATGTAGAATATGG + Intergenic
1199858424 X:151778907-151778929 ATTTCTTCCCATATGGAATGGGG + Intergenic
1201685195 Y:16693640-16693662 CTCCCTTCCCATATGTAATAGGG - Intergenic