ID: 979230683

View in Genome Browser
Species Human (GRCh38)
Location 4:118346058-118346080
Sequence CAAAAGGACATTCCTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979230679_979230683 -3 Left 979230679 4:118346038-118346060 CCAGAAAGGTTTCCTTGTTTCAA 0: 1
1: 0
2: 5
3: 14
4: 248
Right 979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979230683 Original CRISPR CAAAAGGACATTCCTGCAGA GGG Intronic
900576240 1:3383860-3383882 CACCAGGACACACCTGCAGAAGG + Intronic
900576247 1:3383894-3383916 CACCAGGACACACCTGCAGAAGG + Intronic
901511431 1:9719911-9719933 CAATGGGGCAGTCCTGCAGAAGG - Exonic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
906024267 1:42659424-42659446 CAAAAGGACTCTCCTAAAGATGG - Intronic
906102510 1:43272429-43272451 CCAAGGGACAGTACTGCAGAGGG + Intronic
907334378 1:53690738-53690760 GGAAAGGGCATTCCGGCAGAGGG + Intronic
907851088 1:58255717-58255739 CAAAAGGACTTTCTTGCCGTTGG - Intronic
908472103 1:64454305-64454327 TAAAAGGACATTCCTTCATAGGG - Intergenic
908509182 1:64837564-64837586 CTTAAACACATTCCTGCAGAGGG - Intronic
908985565 1:70015801-70015823 CAAAAGAACATACTTGCTGAAGG + Intronic
915974732 1:160377778-160377800 CCAAAGGCAATTCCTGGAGAGGG - Intergenic
916507620 1:165442263-165442285 CAAACAGACCTCCCTGCAGACGG + Intronic
918905783 1:190491156-190491178 TAAAAGCACATTCTTGCAGGTGG - Intergenic
919273919 1:195386846-195386868 CAAAAGTACATTCCTAGAAATGG - Intergenic
920343179 1:205288515-205288537 CAGAGGGACCTTCCTGCAGCTGG - Intergenic
920978691 1:210810986-210811008 CAAAAGGACAGTCCTAAAGTTGG - Intronic
923967160 1:239154795-239154817 CAAATGGTCTTTCCTGTAGATGG + Intergenic
924592652 1:245418245-245418267 CCGGAGGACATTCCTGCTGACGG - Intronic
1062835275 10:631428-631450 CCACAGGACATCCCTGCGGACGG - Intronic
1063245358 10:4212371-4212393 GAAAATGACATTCCTAGAGAGGG - Intergenic
1065223612 10:23520822-23520844 CCACAGGCAATTCCTGCAGAGGG + Intergenic
1065241683 10:23711589-23711611 CAATAGGAAATTACTGTAGAAGG + Intronic
1068350449 10:55837567-55837589 CAAAGGGAAATTCTTGCAGAAGG + Intergenic
1069415804 10:68199940-68199962 GAAAAGGACATTCAGGTAGAGGG - Intronic
1070856021 10:79608619-79608641 GAAGAGGATATCCCTGCAGAGGG + Intergenic
1071067587 10:81654976-81654998 AAAAAAGACATTCCTACAAATGG - Intergenic
1072284028 10:93895411-93895433 CAGAAGGACATTCACCCAGAGGG - Intronic
1072701819 10:97647675-97647697 CAAAAGGGCATTCAGACAGAAGG - Intronic
1072892458 10:99336102-99336124 CAAAATGACATGACTGCAGTTGG - Intronic
1074474439 10:113756684-113756706 AAAGAGCACATTCCAGCAGAAGG + Intronic
1076171265 10:128322147-128322169 GAAAAGGACATTCAAGTAGAGGG + Intergenic
1076830511 10:132992116-132992138 CCACTGGACATTCCTGCAAAAGG + Intergenic
1077582219 11:3423561-3423583 CAAAAAGACCTTCCTGAAGGCGG - Intergenic
1081625497 11:44652905-44652927 GAAATGGACATTCTTGAAGATGG + Intergenic
1081690278 11:45073432-45073454 CAATAGGTCAGTCCTGCAGCTGG - Intergenic
1082264039 11:50100348-50100370 CAAAAGGAAATACCTGCATTAGG - Intergenic
1082964278 11:58949378-58949400 CAAAAGAACATCCCTGAGGAAGG - Intronic
1082977600 11:59088464-59088486 CAAAAGAACATCCCTGGGGAAGG - Intergenic
1083011922 11:59409781-59409803 AAACAGGACATTCCAGCATAAGG + Intergenic
1084239141 11:67806378-67806400 CAAAAAGACCTTCCTGAAGGCGG - Intergenic
1084833298 11:71786463-71786485 CAAAAAGACCTTCCTGAAGGCGG + Intergenic
1085478243 11:76801362-76801384 CAGAGGGACATTCCTGCATTTGG - Intergenic
1087712861 11:101574143-101574165 CAAAAGGACATTGGTGATGAAGG - Intronic
1089117165 11:116104928-116104950 CTCAACGACATTCCTGAAGAAGG - Intergenic
1089659832 11:119978640-119978662 GAAAAGGACACTCCTACAGGCGG - Intergenic
1089977874 11:122748070-122748092 CAAAAGGAGGATCCTGCAAAAGG + Intronic
1090442887 11:126738687-126738709 CAAAAGGACATTTCTGGGAAGGG - Intronic
1090837520 11:130464091-130464113 CCAAATGACCTTCCTGAAGATGG - Intronic
1091105968 11:132920306-132920328 CAAAAGGAGACTCATGCAAATGG + Intronic
1093154354 12:15663416-15663438 CAAAAAGATATTCCTCCTGAGGG + Intronic
1094239509 12:28206036-28206058 AAACAGGACATTCCAGCATAAGG - Intronic
1095952870 12:47791092-47791114 CAAAAGGAGCTTCCTGCTGCAGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097340100 12:58427519-58427541 CACAAGGATATTCCTTGAGAAGG + Intergenic
1097466143 12:59927682-59927704 CAATTTGGCATTCCTGCAGATGG - Intergenic
1097808779 12:63994822-63994844 CAAAAGCTCATGACTGCAGAAGG - Intronic
1098848337 12:75565217-75565239 CAACAGGAAAATTCTGCAGATGG - Intergenic
1100114526 12:91288065-91288087 GCTATGGACATTCCTGCAGAGGG + Intergenic
1101341830 12:103848903-103848925 CAAAAGGACCTGGTTGCAGATGG + Intergenic
1102307328 12:111815060-111815082 CAAAAGGAAATAGATGCAGATGG + Intergenic
1102748397 12:115270761-115270783 CAAAAGGAGACTTCTTCAGAGGG + Intergenic
1106027463 13:25968590-25968612 CAAAAAGACATTGCTGGAGGAGG + Exonic
1110899493 13:80802913-80802935 CAAATGGATATTTCTGCAGAAGG + Intergenic
1112456171 13:99565807-99565829 CAAAAGGCCATTTCTCCAGCAGG - Intergenic
1114600430 14:23951903-23951925 CAAAGGGACAGGCCTGCAGGGGG - Intergenic
1114610075 14:24034306-24034328 CAAACGGACAGGCCTGCAGGGGG - Intergenic
1114701177 14:24680045-24680067 AGAAAGGACATTCCTGCAGGTGG - Intergenic
1117226557 14:53666732-53666754 GAAAAGGAATTTCATGCAGAAGG - Intergenic
1117680057 14:58194652-58194674 CAAAGGGACAAAGCTGCAGAAGG + Intronic
1118233088 14:63972646-63972668 CAAAAAGTAATTACTGCAGAAGG + Intronic
1119268841 14:73283339-73283361 CAATAGGCCATTCCTACTGATGG - Intronic
1119321162 14:73731326-73731348 CATAAACACATTCCAGCAGAGGG + Intronic
1119774972 14:77242667-77242689 AAAAAGGCTTTTCCTGCAGAGGG + Intronic
1121598821 14:95187411-95187433 TAAAACCACATGCCTGCAGAGGG + Exonic
1121639660 14:95476539-95476561 CAAATGGACAGTCCAGCAAAAGG - Intergenic
1126254090 15:46604444-46604466 CAAAAGGAAATTAATGCAGATGG + Intergenic
1127327777 15:57912201-57912223 AAAAAAGACACTCCTGCAGGAGG - Intergenic
1127342502 15:58062699-58062721 AAAAAGCACATTCCTTCATAAGG + Intronic
1129691104 15:77714077-77714099 CAATAGGACACCTCTGCAGAAGG + Intronic
1130631352 15:85571969-85571991 CAAAAGCACATTCCTCTGGAAGG + Intronic
1131184690 15:90264717-90264739 CAGAAGGACAAGCCAGCAGAAGG + Exonic
1131570299 15:93528217-93528239 AATAAAGACATTCCTGGAGAGGG - Intergenic
1133350803 16:5098790-5098812 CAAAAAGACCTTCCTGAAGGCGG - Intergenic
1134222010 16:12362407-12362429 AAAAGGGATATTCCTGCAGCAGG - Intronic
1134318631 16:13142605-13142627 CAAAAGGACTATCTGGCAGAAGG - Intronic
1134842731 16:17414643-17414665 CAAAAGGGCATTTCTGCAAAGGG + Intronic
1135825099 16:25720186-25720208 AAGAAGGACATTCCAGCTGAGGG + Intronic
1138756633 16:59494230-59494252 GACAAGGACACTCCTTCAGAAGG - Intergenic
1139557190 16:67719612-67719634 GACAAGGACATATCTGCAGAAGG + Intergenic
1140359326 16:74331213-74331235 TAAAAAGACAACCCTGCAGAGGG + Intergenic
1140761925 16:78117342-78117364 TTAAAGGCCATTCCTGCGGAAGG - Intronic
1142436964 16:90066067-90066089 CAAATGCTCATTCCTGTAGAAGG - Intronic
1142482137 17:225621-225643 CAGGAGGACAGTCCTGCGGAGGG + Intronic
1144494650 17:15738586-15738608 AAAAAGGAGCTTTCTGCAGAAGG + Intronic
1144639347 17:16928992-16929014 AAAAAGGAACTTTCTGCAGAAGG - Intergenic
1144905606 17:18638090-18638112 AAAAAGGAGCTTTCTGCAGAAGG - Intronic
1146849011 17:36205911-36205933 CAGAAGGTCATACCTGTAGAGGG + Intronic
1148144541 17:45354661-45354683 GGAAAGGACATTCCTGAGGAGGG + Intergenic
1148786972 17:50150321-50150343 CAAAAGTATGTTCCTGCAGATGG - Exonic
1149292521 17:55231118-55231140 AAAAAGGACATTCCAGAAGAGGG + Intergenic
1150502453 17:65664231-65664253 CAAAAGGAAATTCCAGGTGAAGG + Intronic
1150971110 17:70029420-70029442 CAAAAAAACATTCCAGCAGGTGG + Intergenic
1151895188 17:76975234-76975256 CCAAATGACCTACCTGCAGAGGG + Intergenic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1152774380 17:82191313-82191335 CAGACAGACACTCCTGCAGAAGG + Intronic
1153328873 18:3851504-3851526 CAAAAGAATGTTCCTGTAGAGGG - Intronic
1153916506 18:9750398-9750420 GAAAAGGACATTCGTCTAGAAGG + Intronic
1157280188 18:46341918-46341940 CAAAAGGCCATCCCTACACATGG + Intronic
1159577884 18:70201915-70201937 CAAAAGTAATTTCCAGCAGATGG - Exonic
1160484381 18:79275470-79275492 GCTAAGGACATTCCTGCAAATGG - Intronic
1161185328 19:2914830-2914852 CAAAGGGACATGACTACAGATGG - Intronic
1162043995 19:7987039-7987061 CGGAAGGACATTCCTGCAGAGGG + Intronic
1164617876 19:29677472-29677494 GGAGAGGACATTCCAGCAGAGGG + Intergenic
1166124051 19:40703222-40703244 GAAAAGGACAGTCCTGGGGATGG - Intronic
1167218977 19:48184986-48185008 CACAGGGACAATCCTGCAGAGGG - Intronic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167884625 19:52489983-52490005 CAATAGGATGTTTCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167893592 19:52562473-52562495 CAATTGGATGTTCCTGCAGATGG - Intronic
1167911724 19:52709144-52709166 CAATAGGATGTTCCTGCAGTTGG + Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
925491837 2:4403722-4403744 CAAGAGGACAGGCCTCCAGATGG - Intergenic
926147241 2:10404288-10404310 CAAAAGGGCATGGCTGGAGAAGG - Intronic
926237771 2:11059690-11059712 CAAAAAGACATTAATGCACATGG + Intergenic
927892358 2:26759716-26759738 CAGAAGGGCTTTCTTGCAGATGG - Intergenic
929545834 2:42854812-42854834 AAAGAGGACATTCCGGGAGAAGG + Intergenic
929560686 2:42954570-42954592 CAAAAGAACATTTCTGCTCATGG - Intergenic
932766268 2:74472454-74472476 CCGTAGGACCTTCCTGCAGACGG - Exonic
933337680 2:80979762-80979784 CTAAATGTCATACCTGCAGATGG - Intergenic
933984626 2:87580516-87580538 AGTGAGGACATTCCTGCAGATGG - Intergenic
936120238 2:109736051-109736073 TAAAAGAACTTGCCTGCAGATGG - Intergenic
936309225 2:111370284-111370306 AGTGAGGACATTCCTGCAGATGG + Intergenic
941540672 2:166780038-166780060 CAAAAGGACAAGTCTGCTGATGG - Intergenic
947900039 2:233713600-233713622 CCACATGACATTCCTGCAAAGGG + Exonic
947900748 2:233719429-233719451 CCACATGACATTCCTGCAAAGGG + Exonic
947904188 2:233747821-233747843 CCACATGACATTCCTGCAAAGGG + Intronic
1169625617 20:7565201-7565223 CAAAAGAGCAGTCCTGCACAAGG - Intergenic
1170484612 20:16803819-16803841 CAAAAGAAAATGCCTGCTGAAGG - Intergenic
1171066758 20:22024809-22024831 AAAAAAGACATTCATGCAAATGG - Intergenic
1172497877 20:35402094-35402116 CAAAAGGATATTTCCACAGAGGG + Intronic
1174379178 20:50145858-50145880 CAAAAGGACATCACTTCAGCAGG - Intronic
1175608267 20:60329156-60329178 TAAGAGGAAACTCCTGCAGAGGG + Intergenic
1177940144 21:27399989-27400011 CAAAATGAAATTCTTGCAGCTGG - Intergenic
1178052221 21:28760186-28760208 GAAAAGGAAATCCCTGTAGATGG + Intergenic
1180021526 21:45131471-45131493 CAAAAGGACTTCCATGCAGGTGG - Intronic
951159450 3:19399493-19399515 CAAAATCACATTCCTGAAGCAGG - Intronic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
952627132 3:35419255-35419277 CAATAGGAGATTCCTGGAAAAGG - Intergenic
955468611 3:59262694-59262716 CAAAAGTACTTTAGTGCAGAAGG + Intergenic
955541560 3:59982235-59982257 CAAAATAACATCCCTGAAGATGG + Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
956291802 3:67668487-67668509 CAAAAGGACAATAGTGCAGAGGG - Intergenic
959563909 3:107814966-107814988 AAAAAGGACTTTACTACAGAAGG + Intergenic
960231019 3:115227535-115227557 CAAAAGGAGATTCATGGGGAAGG + Intergenic
960880652 3:122341390-122341412 CAAAAGGAGATTCATTCAAATGG - Intronic
961096027 3:124157706-124157728 GAAAAGGACCCTCCTGCAGATGG - Intronic
961242942 3:125427995-125428017 AAACAGGACATTCCAGCACAAGG + Intergenic
961299776 3:125915539-125915561 CAAAAAGACCTTCCTGAAGGCGG + Intergenic
961596384 3:128021353-128021375 CAACAGGACATTCCAGCATAAGG + Intergenic
962349850 3:134648738-134648760 CAGAAGGCCCTTCCAGCAGAAGG + Intronic
963604851 3:147405382-147405404 CAAAGGGAGTTTCCTGAAGACGG + Intronic
963649259 3:147957408-147957430 GAAAAAGACATTGCGGCAGATGG - Intergenic
964169004 3:153744768-153744790 CAAAAAGACACTTCTGTAGAGGG - Intergenic
964941657 3:162164701-162164723 CAAAAGGACACCCCTGAACATGG + Intergenic
967011517 3:185439242-185439264 GGAAGGGACATTCATGCAGAGGG + Intronic
968266289 3:197366025-197366047 CACCAGGTCATTCCTGCACAAGG - Intergenic
968997880 4:3956443-3956465 CAAAAAGACCTTCCTGAAGGCGG - Intergenic
969816445 4:9691377-9691399 CAAAAAGACCTTCCTGAAGGCGG + Intergenic
972457639 4:39269938-39269960 TAAAACGACATTACTGCAAAGGG - Intronic
972632024 4:40850402-40850424 CCAAAGAGAATTCCTGCAGAAGG - Intronic
972982419 4:44722360-44722382 TAAAAGTACATTACTGAAGAAGG + Intronic
974689753 4:65281736-65281758 CAAAAGGAAAATTCTCCAGAGGG - Intergenic
977564754 4:98569450-98569472 TAATAGGACGTCCCTGCAGATGG - Intronic
979230683 4:118346058-118346080 CAAAAGGACATTCCTGCAGAGGG + Intronic
980814316 4:137923258-137923280 AAACAGGACATTCCAGCATAGGG + Intergenic
982583581 4:157209316-157209338 CAAAAGAACAAAACTGCAGAAGG + Intronic
987166926 5:15208724-15208746 CAAAAGGAGACCCCTGCAGTGGG + Intergenic
987394793 5:17413004-17413026 CATCATGCCATTCCTGCAGAAGG + Intergenic
988031980 5:25773902-25773924 CTAAAGGAAATTCCTCCAGAAGG + Intergenic
993609178 5:90033168-90033190 CACAAAGACATTCCTCGAGAAGG + Intergenic
995591219 5:113701732-113701754 GGAAAGAACATTCCTACAGAAGG - Intergenic
995859893 5:116629929-116629951 CTAAAGGCAATTCCTGGAGAGGG - Intergenic
998325025 5:141272577-141272599 CAAAAGGACCTCCTTGAAGATGG - Intergenic
1000187270 5:158871497-158871519 CAGAAAGTCATTCTTGCAGATGG + Intronic
1000795910 5:165664108-165664130 AATTAGGGCATTCCTGCAGATGG - Intergenic
1001756198 5:174172290-174172312 CCTAATGACATTCCTGAAGATGG + Intronic
1002280419 5:178126681-178126703 CTAAGGGAAGTTCCTGCAGAAGG + Intergenic
1002359174 5:178656591-178656613 CAGACGGACATTCCAACAGATGG + Intergenic
1003688030 6:8323741-8323763 CCAAGGGACATTGCTGCTGAAGG - Intergenic
1004765998 6:18727654-18727676 AAACAGGACATTCCAGCATAAGG + Intergenic
1004947226 6:20629525-20629547 GAAAAGGGCATTCCTATAGAGGG - Intronic
1005202910 6:23367176-23367198 CAAAATGACAATCCACCAGAGGG - Intergenic
1007439576 6:41846668-41846690 CAAAAGGAGATTACAGCAAAAGG + Intronic
1007494705 6:42251892-42251914 GAACTGGTCATTCCTGCAGAGGG - Intronic
1007727808 6:43927228-43927250 CTGAGGGACATTCCAGCAGAGGG - Intergenic
1008502108 6:52193624-52193646 CAAAAAGACATCTCTGGAGATGG + Intergenic
1011341941 6:86325714-86325736 TAACAGGACATTCCAGCATAAGG + Intergenic
1013572819 6:111446776-111446798 CAAAAGGAGATTCCCACTGAAGG - Intronic
1014211300 6:118711111-118711133 CAAAAGAACACTAGTGCAGATGG + Intergenic
1015615852 6:135074185-135074207 AACAAAGACATGCCTGCAGAAGG + Intronic
1015758712 6:136634277-136634299 CAAAAGGACATTCAGGGAGAGGG + Intronic
1018199867 6:161384711-161384733 GTAAAGGACATTCCAGCAGAGGG - Intronic
1020386160 7:7605060-7605082 CAAAAGGATAATCTTGCAGTCGG - Intronic
1021355441 7:19649398-19649420 GAAAAGAACAATCCTGGAGAGGG + Intergenic
1021532661 7:21665956-21665978 TAAAAGCACACTCCAGCAGATGG - Intronic
1021777521 7:24068105-24068127 CCAAAGATCATTGCTGCAGAAGG + Intergenic
1022414706 7:30167973-30167995 CAGAAGGACGTTCCTGTAGGAGG + Intergenic
1022744709 7:33159381-33159403 AAACAGGACATTCCAGCATAAGG - Intronic
1023098054 7:36683288-36683310 CTAAAGTTCATTCCTCCAGAAGG - Intronic
1023358460 7:39391700-39391722 CTGAAGGACAGTACTGCAGAAGG - Intronic
1023453801 7:40316387-40316409 TAAAAGGAGATACATGCAGAGGG + Intronic
1023964429 7:44955443-44955465 CAGAAGAATAATCCTGCAGATGG - Intergenic
1024167524 7:46749699-46749721 GAGAAGGACATCCCTGCAGAAGG + Intronic
1024547683 7:50536096-50536118 CAAAAGGAAATTCCTTATGAGGG - Intronic
1026541339 7:71282571-71282593 CAAAAGGAAAATCCTGCATAAGG + Intronic
1026825107 7:73576829-73576851 AAAAAAGACATTCCTGCCAATGG - Intronic
1027948886 7:84786485-84786507 CTAATGGATATTCCTCCAGATGG + Intergenic
1028035724 7:85979250-85979272 AAAAAGGAGACTCCTGAAGATGG + Intergenic
1032484322 7:132272771-132272793 AAAATGGACATTTCAGCAGAAGG - Intronic
1032800143 7:135311097-135311119 GAAACTGACATTCCAGCAGAAGG - Intergenic
1033774126 7:144587920-144587942 CAGAACTTCATTCCTGCAGAAGG + Intronic
1034009429 7:147512250-147512272 CAAAAGGACAAGTCTGCAAATGG - Intronic
1034411425 7:150944339-150944361 CAAGAGGAGCTTCCTGAAGAGGG - Intergenic
1037414224 8:18631568-18631590 CAAAAGGGCACACCTGAAGATGG - Intronic
1037646944 8:20800803-20800825 CAAAAGTGCATTCTTTCAGAGGG + Intergenic
1038185667 8:25272543-25272565 CAAAGGAACATCCCTGCTGAAGG - Intronic
1045931813 8:107635859-107635881 CAAAAGGAAATGCCTGTAAAGGG - Intergenic
1047104151 8:121714863-121714885 GAAAAGGACAGAACTGCAGAGGG - Intergenic
1049295657 8:141834589-141834611 CAAACGTACATTCCTGGAGGAGG + Intergenic
1051680929 9:19607299-19607321 CAAAAGGGAACTCCTTCAGAAGG - Intronic
1051691837 9:19722249-19722271 CAAAAGAACACTCTTGAAGATGG - Intronic
1052415812 9:28175668-28175690 CAAAAGCATATTCCTGGATAGGG - Intronic
1055003387 9:71479069-71479091 CAAAAGGAAACACCTGGAGAAGG - Intergenic
1055326653 9:75137277-75137299 GAAAAGCACATGCCTGCGGAGGG - Intronic
1055774918 9:79757119-79757141 CAATTGGACATTCCTTCAGCAGG - Intergenic
1056242203 9:84659048-84659070 GTAAAGGAGATTCCTGCAAATGG + Intergenic
1059177496 9:112180566-112180588 CAGAAGGGCATTTCTCCAGAGGG - Intergenic
1060875484 9:127080476-127080498 CAAAAGGACATGCCTGTGGAGGG + Intronic
1061195031 9:129102876-129102898 CAAGAGGAGATTCCAGCAGCTGG + Intronic
1062161376 9:135082099-135082121 CAAAAGGACATCCCAGCAGCAGG + Intronic
1062309951 9:135930197-135930219 CCAGAGGACATTCCTGCTGGGGG - Intergenic
1062453495 9:136625222-136625244 CAGCACGAGATTCCTGCAGATGG - Intergenic
1062712239 9:137982344-137982366 CATAAGGACACTCCGGCAGCTGG - Intronic
1186907352 X:14126032-14126054 GAAAAGGACATTCCAGAAGTTGG - Intergenic
1187176186 X:16898167-16898189 CACCCGGACATTCCTGCAGAAGG - Intergenic
1187691255 X:21869548-21869570 TAACAGGACAATCCTGTAGATGG - Exonic
1189757894 X:44290278-44290300 CAAAGGGAGATTGCTGAAGAAGG - Intronic
1191135459 X:57059083-57059105 GACAAGGAGATTCCTTCAGACGG - Intergenic
1192226358 X:69230899-69230921 GAGAAGGACACTCCTGTAGAGGG - Intergenic
1192951830 X:76025828-76025850 CAAAAGGAAATTACTGGAGTGGG + Intergenic
1194665705 X:96675200-96675222 GAAAAGGGCATTCAGGCAGATGG - Intergenic
1195888370 X:109666313-109666335 AAAAAGGACATTCCAAGAGAAGG + Intronic
1197554206 X:127934609-127934631 AAACAGGACATTCCAGCATAAGG + Intergenic
1199433076 X:147782606-147782628 CTAAAGGATATTACTGCAGGTGG + Intergenic
1201623942 Y:15992621-15992643 AGAAAGGCCATTCCTGCAGAAGG - Intergenic