ID: 979237175

View in Genome Browser
Species Human (GRCh38)
Location 4:118414339-118414361
Sequence GGCACCATCCAATCAGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979237175_979237179 -8 Left 979237175 4:118414339-118414361 CCCCAAGCTGATTGGATGGTGCC No data
Right 979237179 4:118414354-118414376 ATGGTGCCTGTCCACATTGAGGG No data
979237175_979237178 -9 Left 979237175 4:118414339-118414361 CCCCAAGCTGATTGGATGGTGCC No data
Right 979237178 4:118414353-118414375 GATGGTGCCTGTCCACATTGAGG No data
979237175_979237182 10 Left 979237175 4:118414339-118414361 CCCCAAGCTGATTGGATGGTGCC No data
Right 979237182 4:118414372-118414394 GAGGGCAGAACTTTCTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979237175 Original CRISPR GGCACCATCCAATCAGCTTG GGG (reversed) Intergenic