ID: 979237176

View in Genome Browser
Species Human (GRCh38)
Location 4:118414340-118414362
Sequence AGGCACCATCCAATCAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979237176_979237179 -9 Left 979237176 4:118414340-118414362 CCCAAGCTGATTGGATGGTGCCT No data
Right 979237179 4:118414354-118414376 ATGGTGCCTGTCCACATTGAGGG No data
979237176_979237182 9 Left 979237176 4:118414340-118414362 CCCAAGCTGATTGGATGGTGCCT No data
Right 979237182 4:118414372-118414394 GAGGGCAGAACTTTCTTGCTTGG No data
979237176_979237178 -10 Left 979237176 4:118414340-118414362 CCCAAGCTGATTGGATGGTGCCT No data
Right 979237178 4:118414353-118414375 GATGGTGCCTGTCCACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979237176 Original CRISPR AGGCACCATCCAATCAGCTT GGG (reversed) Intergenic