ID: 979237178 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:118414353-118414375 |
| Sequence | GATGGTGCCTGTCCACATTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 979237176_979237178 | -10 | Left | 979237176 | 4:118414340-118414362 | CCCAAGCTGATTGGATGGTGCCT | No data | ||
| Right | 979237178 | 4:118414353-118414375 | GATGGTGCCTGTCCACATTGAGG | No data | ||||
| 979237175_979237178 | -9 | Left | 979237175 | 4:118414339-118414361 | CCCCAAGCTGATTGGATGGTGCC | No data | ||
| Right | 979237178 | 4:118414353-118414375 | GATGGTGCCTGTCCACATTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 979237178 | Original CRISPR | GATGGTGCCTGTCCACATTG AGG | Intergenic | ||