ID: 979238110

View in Genome Browser
Species Human (GRCh38)
Location 4:118424247-118424269
Sequence ATGGCTCCACACTGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979238110_979238117 15 Left 979238110 4:118424247-118424269 CCAAGATGGCAGTGTGGAGCCAT No data
Right 979238117 4:118424285-118424307 CGCACCCAGCAGTCGGCTGTGGG No data
979238110_979238114 8 Left 979238110 4:118424247-118424269 CCAAGATGGCAGTGTGGAGCCAT No data
Right 979238114 4:118424278-118424300 TCTGCCGCGCACCCAGCAGTCGG No data
979238110_979238116 14 Left 979238110 4:118424247-118424269 CCAAGATGGCAGTGTGGAGCCAT No data
Right 979238116 4:118424284-118424306 GCGCACCCAGCAGTCGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979238110 Original CRISPR ATGGCTCCACACTGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr