ID: 979246009

View in Genome Browser
Species Human (GRCh38)
Location 4:118505427-118505449
Sequence AATCTATTCTGTGACATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979246006_979246009 -9 Left 979246006 4:118505413-118505435 CCTAAAATTTTTCCAATCTATTC No data
Right 979246009 4:118505427-118505449 AATCTATTCTGTGACATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979246009 Original CRISPR AATCTATTCTGTGACATCCA GGG Intergenic
No off target data available for this crispr