ID: 979257370

View in Genome Browser
Species Human (GRCh38)
Location 4:118619324-118619346
Sequence GCTACTTGGGAGTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345578
Summary {0: 31, 1: 494, 2: 16352, 3: 113220, 4: 215481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257370_979257380 11 Left 979257370 4:118619324-118619346 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 979257380 4:118619358-118619380 GTGTGCACCACCACCACACCTGG No data
979257370_979257385 30 Left 979257370 4:118619324-118619346 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257370 Original CRISPR GCTACTTGGGAGTCTGGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr