ID: 979257371

View in Genome Browser
Species Human (GRCh38)
Location 4:118619325-118619347
Sequence AGCTACTTGGGAGTCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92442
Summary {0: 33, 1: 496, 2: 14727, 3: 30337, 4: 46849}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257371_979257380 10 Left 979257371 4:118619325-118619347 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 979257380 4:118619358-118619380 GTGTGCACCACCACCACACCTGG No data
979257371_979257385 29 Left 979257371 4:118619325-118619347 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257371 Original CRISPR AGCTACTTGGGAGTCTGGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr