ID: 979257373

View in Genome Browser
Species Human (GRCh38)
Location 4:118619328-118619350
Sequence TCCAGCTACTTGGGAGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 590101
Summary {0: 85, 1: 6786, 2: 109153, 3: 219239, 4: 254838}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257373_979257385 26 Left 979257373 4:118619328-118619350 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257373_979257380 7 Left 979257373 4:118619328-118619350 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 979257380 4:118619358-118619380 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257373 Original CRISPR TCCAGCTACTTGGGAGTCTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr