ID: 979257374

View in Genome Browser
Species Human (GRCh38)
Location 4:118619329-118619351
Sequence TTCCAGCTACTTGGGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257374_979257385 25 Left 979257374 4:118619329-118619351 CCCAGACTCCCAAGTAGCTGGAA No data
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257374_979257380 6 Left 979257374 4:118619329-118619351 CCCAGACTCCCAAGTAGCTGGAA No data
Right 979257380 4:118619358-118619380 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257374 Original CRISPR TTCCAGCTACTTGGGAGTCT GGG (reversed) Intergenic
No off target data available for this crispr