ID: 979257378

View in Genome Browser
Species Human (GRCh38)
Location 4:118619337-118619359
Sequence ACCCGTAGTTCCAGCTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383859
Summary {0: 25, 1: 987, 2: 20064, 3: 110438, 4: 252345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257378_979257380 -2 Left 979257378 4:118619337-118619359 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 979257380 4:118619358-118619380 GTGTGCACCACCACCACACCTGG No data
979257378_979257385 17 Left 979257378 4:118619337-118619359 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257378 Original CRISPR ACCCGTAGTTCCAGCTACTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr