ID: 979257379

View in Genome Browser
Species Human (GRCh38)
Location 4:118619338-118619360
Sequence CACCCGTAGTTCCAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279565
Summary {0: 29, 1: 1597, 2: 33463, 3: 109179, 4: 135297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257379_979257385 16 Left 979257379 4:118619338-118619360 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257379_979257380 -3 Left 979257379 4:118619338-118619360 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 979257380 4:118619358-118619380 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257379 Original CRISPR CACCCGTAGTTCCAGCTACT TGG (reversed) Intergenic
Too many off-targets to display for this crispr