ID: 979257385

View in Genome Browser
Species Human (GRCh38)
Location 4:118619377-118619399
Sequence CTGGCTAATGTTTCTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979257379_979257385 16 Left 979257379 4:118619338-118619360 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257370_979257385 30 Left 979257370 4:118619324-118619346 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257378_979257385 17 Left 979257378 4:118619337-118619359 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257373_979257385 26 Left 979257373 4:118619328-118619350 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257371_979257385 29 Left 979257371 4:118619325-118619347 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257374_979257385 25 Left 979257374 4:118619329-118619351 CCCAGACTCCCAAGTAGCTGGAA No data
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data
979257375_979257385 24 Left 979257375 4:118619330-118619352 CCAGACTCCCAAGTAGCTGGAAC No data
Right 979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979257385 Original CRISPR CTGGCTAATGTTTCTTTTTT TGG Intergenic
No off target data available for this crispr