ID: 979258196

View in Genome Browser
Species Human (GRCh38)
Location 4:118625715-118625737
Sequence TCTCAACACCACCACGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979258196_979258208 23 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258208 4:118625761-118625783 GGAGGAGGCCAGGGAGTTGCTGG 0: 13
1: 36
2: 22
3: 116
4: 787
979258196_979258209 24 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258209 4:118625762-118625784 GAGGAGGCCAGGGAGTTGCTGGG 0: 31
1: 18
2: 13
3: 67
4: 529
979258196_979258202 1 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258202 4:118625739-118625761 ATGGTCAGAGGGGAGAACTAGGG No data
979258196_979258210 27 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258210 4:118625765-118625787 GAGGCCAGGGAGTTGCTGGGTGG 0: 13
1: 10
2: 11
3: 65
4: 829
979258196_979258203 2 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258203 4:118625740-118625762 TGGTCAGAGGGGAGAACTAGGGG No data
979258196_979258205 8 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258205 4:118625746-118625768 GAGGGGAGAACTAGGGGAGGAGG No data
979258196_979258207 14 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258207 4:118625752-118625774 AGAACTAGGGGAGGAGGCCAGGG No data
979258196_979258200 -9 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258200 4:118625729-118625751 GTGTTGAGAGATGGTCAGAGGGG No data
979258196_979258199 -10 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258199 4:118625728-118625750 GGTGTTGAGAGATGGTCAGAGGG No data
979258196_979258206 13 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258206 4:118625751-118625773 GAGAACTAGGGGAGGAGGCCAGG No data
979258196_979258204 5 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258204 4:118625743-118625765 TCAGAGGGGAGAACTAGGGGAGG No data
979258196_979258211 28 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258211 4:118625766-118625788 AGGCCAGGGAGTTGCTGGGTGGG 0: 13
1: 31
2: 9
3: 48
4: 425
979258196_979258201 0 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258201 4:118625738-118625760 GATGGTCAGAGGGGAGAACTAGG No data
979258196_979258212 29 Left 979258196 4:118625715-118625737 CCAGGGTCGTGGTGGTGTTGAGA No data
Right 979258212 4:118625767-118625789 GGCCAGGGAGTTGCTGGGTGGGG 0: 16
1: 9
2: 27
3: 59
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979258196 Original CRISPR TCTCAACACCACCACGACCC TGG (reversed) Intergenic
No off target data available for this crispr