ID: 979266445

View in Genome Browser
Species Human (GRCh38)
Location 4:118708713-118708735
Sequence AGAAATAACCTAAGGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979266442_979266445 30 Left 979266442 4:118708660-118708682 CCTAGTGAAATATTTTTCATTTT 0: 1
1: 0
2: 10
3: 152
4: 1517
Right 979266445 4:118708713-118708735 AGAAATAACCTAAGGATGATGGG 0: 1
1: 0
2: 1
3: 11
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979266445 Original CRISPR AGAAATAACCTAAGGATGAT GGG Intronic
901238314 1:7679278-7679300 AGAATGAACCCAAGGATGCTGGG + Intronic
901246148 1:7732817-7732839 AGAGATAACTTAAGGATTAGGGG - Intronic
902727867 1:18349343-18349365 AGAAGAAAAATAAGGATGATGGG + Intronic
904659968 1:32076924-32076946 GGAAATACCCTAAGGCTGAAGGG - Intronic
906009098 1:42506586-42506608 AAATATAACCTAAAGAAGATTGG + Intronic
906391577 1:45421716-45421738 AGCCATTACCTAAGGATGTTGGG + Exonic
906440205 1:45836487-45836509 AAAAATAAATTAAGAATGATGGG - Intronic
906626320 1:47328855-47328877 AGAAATAAGCCAAGGAAGTTAGG - Intergenic
907190255 1:52642118-52642140 AGAAATTACCTAAGGCTGGAAGG + Intronic
909397933 1:75191722-75191744 AGAAATGACCTAAAGATAATGGG + Intergenic
909561352 1:77012470-77012492 AGAAAAAACCTAGGGATAGTAGG + Intronic
910030140 1:82710040-82710062 AGAAATGAGCAAAGGATGAAAGG - Intergenic
912024971 1:105158514-105158536 AGAAATAGCCCCAAGATGATGGG - Intergenic
912865162 1:113250075-113250097 ACAACTAATCTAAAGATGATTGG + Intergenic
917452284 1:175157183-175157205 AGCAAAAACCTAAGGAAGAATGG - Intronic
918405465 1:184207849-184207871 AGATATAACCTGGGGATGATGGG + Intergenic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
920754199 1:208713202-208713224 AGAATTAACCTTAAGATAATTGG + Intergenic
921237144 1:213144662-213144684 TGAAATCACCTAAGGAGAATAGG - Intronic
921323343 1:213965683-213965705 AAAAATGACCCAAAGATGATGGG + Intergenic
921703037 1:218288881-218288903 AGAAATAACATATGGATTTTAGG - Intronic
922680902 1:227594848-227594870 AGAAGTAACCTAAGGAAAAAAGG - Intronic
1062879370 10:965567-965589 AGAAACAAACTAAGGAAGAAAGG + Intergenic
1067235754 10:44447735-44447757 GGTACTAACCTAAGGATCATTGG + Intergenic
1068570936 10:58628328-58628350 AGAAGTAACCTCAGTATGATGGG - Intronic
1069335109 10:67339438-67339460 CGATATATCCTAAGGATTATAGG + Intronic
1069564387 10:69453462-69453484 TGAAAGAGCCTAAGGTTGATGGG + Intronic
1072117731 10:92380026-92380048 AGAAATCCCCTAAGGCTGAAGGG - Intergenic
1072492903 10:95925812-95925834 AGAAAGAACCAAAGGATTTTAGG + Intronic
1072975926 10:100057766-100057788 AGAAATAACGTGAGGAGTATTGG + Intronic
1074226623 10:111490443-111490465 ATAAATAACCTAATGATTTTGGG - Intergenic
1074555351 10:114484215-114484237 AGAAGTTACCTAACTATGATGGG + Intronic
1076473438 10:130736102-130736124 AGGAGTGACCAAAGGATGATGGG + Intergenic
1076473458 10:130736210-130736232 AGGAGTGACCAAAGGATGATGGG + Intergenic
1085436889 11:76513204-76513226 AGAAATAAACTAAGAAAGATAGG + Intronic
1085752840 11:79177276-79177298 AGCACTAAAGTAAGGATGATGGG - Intronic
1087603844 11:100350223-100350245 TGAAATATCCTAAGGAAGTTTGG - Intronic
1088195647 11:107270705-107270727 TTAAATTACCTAAGGAAGATGGG - Intergenic
1089890675 11:121877696-121877718 AGAAATAACCAATGGGAGATAGG + Intergenic
1089903040 11:122008265-122008287 AGAAATAGCCTAAGAATTCTGGG - Intergenic
1089905979 11:122039081-122039103 AAAAATCACCTATGCATGATGGG + Intergenic
1090072460 11:123555665-123555687 AGAAATAACTGTAGGATCATGGG + Intronic
1090512769 11:127393307-127393329 AGTAATAACCTAAGGAGGATTGG + Intergenic
1090568436 11:128021202-128021224 AGAAAAAACATAAGGAGGAGGGG + Intergenic
1093194467 12:16113280-16113302 AGAAATTACCTATGGACTATGGG + Intergenic
1093353278 12:18129721-18129743 AGAAATAACCTGAAAATGAAAGG - Intronic
1093895661 12:24571785-24571807 TGGCATAACCTAAGGATGCTAGG - Intergenic
1093934464 12:24985842-24985864 AGCAATAACCAAAGGATGCTGGG - Intergenic
1093954878 12:25204605-25204627 AGAAATAAGCTAAAAATAATTGG - Exonic
1094155623 12:27333968-27333990 AGAAATAACTGAAGGAAGACTGG + Intronic
1096333585 12:50735977-50735999 AGCAATTTACTAAGGATGATAGG + Intronic
1097342359 12:58453783-58453805 AGTACTAACCTAAGTATAATAGG - Intergenic
1097494721 12:60316213-60316235 AAAAATAACATAAGTATTATGGG - Intergenic
1098201684 12:68063107-68063129 AGAACAAACCTATGGCTGATAGG - Intergenic
1098471163 12:70846073-70846095 AGCAACAACTTAAGGATTATGGG + Intronic
1099461227 12:82924038-82924060 AGCAATAATTTAAGGAAGATAGG + Intronic
1099951690 12:89310992-89311014 AGAAAAAAACAAAGGTTGATGGG - Intergenic
1099999856 12:89820162-89820184 AGAAATAAATGAAGCATGATTGG - Intergenic
1105246864 13:18660584-18660606 GGAAATAATCTAAGGAAGACAGG - Intergenic
1105736369 13:23275586-23275608 AGAAATAACCTAAGTTTCACTGG + Intronic
1105964920 13:25374888-25374910 AAAAATAAACTAATGATGAAAGG + Intronic
1107087368 13:36440246-36440268 AAAAAGAACTGAAGGATGATTGG - Intronic
1107617892 13:42190758-42190780 AACAATAAACTAAGGATTATAGG + Intronic
1109014256 13:56988637-56988659 AAAAATAAAGTAAGGAAGATAGG + Intergenic
1109925377 13:69130603-69130625 AGAAATATCCTAAAAATAATTGG + Intergenic
1110534083 13:76630785-76630807 AGAAATAAACAAATGATGACTGG + Intergenic
1110953010 13:81519040-81519062 AAATATAACCTAAAGAAGATTGG + Intergenic
1112595049 13:100800134-100800156 AGCAAGAACTTAAGGATGATGGG - Intergenic
1113080410 13:106513905-106513927 AGAGATAAAGCAAGGATGATAGG + Intronic
1114862441 14:26541091-26541113 AGACATAAGCAAAGAATGATTGG + Intronic
1115163180 14:30418611-30418633 GTAAATGTCCTAAGGATGATGGG - Intergenic
1116135200 14:40914580-40914602 AGAAATAACCGAAGTATCATTGG - Intergenic
1116342809 14:43747216-43747238 ATCAATAGCCTAAGGATGTTAGG + Intergenic
1116671434 14:47847294-47847316 AGACTGAACCTAAGTATGATAGG + Intergenic
1118793649 14:69119380-69119402 AGAAATAATTTAAGAAGGATAGG + Intronic
1119202402 14:72766316-72766338 AGAAATAACTGAAAGATGAAGGG + Intronic
1120453518 14:84701936-84701958 AAAAATAGCCAAAGGATGCTGGG + Intergenic
1121131826 14:91454271-91454293 AGAATTACCCTAAGGCTCATGGG + Intergenic
1121799456 14:96761646-96761668 AGAAATAACCTTGAGATAATTGG - Intergenic
1122486318 14:102084057-102084079 AAAGATAACCTGAAGATGATGGG + Intronic
1122555636 14:102578090-102578112 AGAATTGACCTCAGGATGAACGG + Intergenic
1123952093 15:25289227-25289249 AGAACTAATATAAGGATTATTGG + Intergenic
1124472967 15:30004467-30004489 AGAAATAAAATAGGGATGAAAGG + Intergenic
1125378471 15:39060151-39060173 AGAAAGCTCCTAAGGATGAGGGG + Intergenic
1126973704 15:54149591-54149613 AGAAATTAACAAAGGAAGATTGG - Intronic
1128656341 15:69464778-69464800 AGAAAAAAAGTATGGATGATAGG + Intergenic
1134392164 16:13830123-13830145 AAAAATGACGTAATGATGATAGG + Intergenic
1134810654 16:17164198-17164220 TGAAATAACTTAAAGATTATGGG - Intronic
1135614951 16:23903124-23903146 AGAAATAACATAAGTAGGCTGGG - Intronic
1135893735 16:26379786-26379808 AGGACTAATCTAAGGAAGATGGG + Intergenic
1136348700 16:29693558-29693580 ATAAATAAAATGAGGATGATGGG - Intronic
1138963500 16:62055472-62055494 AGAAATAAACTAAGGGAGAAAGG - Intergenic
1140570101 16:76093910-76093932 AGAAAAAAACTAAGGCTTATGGG - Intergenic
1140741376 16:77944414-77944436 ATAAATGACCGAAGGATAATGGG + Intronic
1142663201 17:1445639-1445661 AGAATTAGCCTAATGGTGATAGG - Intronic
1144535590 17:16086745-16086767 AGAAGTACCCTAAGAGTGATTGG - Intronic
1145745548 17:27317112-27317134 AAAAATAGATTAAGGATGATGGG + Intergenic
1149094698 17:52826594-52826616 AAATATAACCTAAAGAAGATTGG + Intergenic
1149174602 17:53854274-53854296 AGAACAAACCTACGGTTGATTGG + Intergenic
1149523325 17:57334870-57334892 AGAGACAACCTAAGGCTGGTAGG + Intronic
1150946534 17:69752121-69752143 AAAAATAAGCTAAGGGTGAAGGG - Intergenic
1152273371 17:79338873-79338895 AACAATAGCCTAAGGATTATGGG - Intronic
1159685829 18:71418753-71418775 AGAAATATATTTAGGATGATGGG + Intergenic
1165582615 19:36880988-36881010 ACAAAAACCCTAAGGATAATGGG + Intronic
1166964865 19:46523242-46523264 AGAAATAACCTAAGCTGGCTGGG + Intronic
1168489871 19:56799805-56799827 ATAAATAACCAAAGTATGCTAGG + Intronic
928966827 2:36984283-36984305 AGAAATATGCTAAGCATTATAGG + Intronic
931862246 2:66367801-66367823 AGAAAAAACTTAAGGCTGACAGG - Intergenic
932108266 2:68969104-68969126 AGAGATAACCTATGGATGAAAGG - Intergenic
932933276 2:76068039-76068061 GGAAATAGCATAAGGATGGTGGG + Intergenic
933920679 2:87041937-87041959 ATTAATAACCTAAGGATGCAGGG + Intergenic
933930946 2:87151849-87151871 ATTAATAACCTAAGGATGCAGGG - Intergenic
934002319 2:87727961-87727983 ATTAATAACCTAAGGATGCAGGG - Intergenic
934537083 2:95143679-95143701 AGAAATAACCTCTAGATCATTGG + Intronic
936362177 2:111813594-111813616 ATTAATAACCTAAGGATGCAGGG + Intronic
939519902 2:143216951-143216973 AGAAAAAAAGTAAGGTTGATAGG + Intronic
939544292 2:143533923-143533945 AGTAACAACCTAAGGCTTATTGG - Intronic
940478508 2:154197105-154197127 TCAAATAACTTAAGGATGTTGGG - Intronic
941273434 2:163459687-163459709 AGAAGTAACCTAGGGATTTTTGG - Intergenic
944439260 2:199726021-199726043 AGACCTAACCTATGAATGATTGG - Intergenic
944979214 2:205094904-205094926 AGAAAAAACTTAAGGAAGTTGGG - Intronic
948791953 2:240383733-240383755 AGAAAGAACAAAAGGAAGATGGG - Intergenic
1170312571 20:15008604-15008626 AGAAATAATTTAAGTATGAAAGG + Intronic
1172407783 20:34702427-34702449 AAAAATAACCCAAGGCTGAGGGG - Intronic
1177542563 21:22514455-22514477 AGAAATAACTGAAAGATGATTGG + Intergenic
1177955927 21:27599348-27599370 AGCAATAAACAAAGGCTGATTGG + Intergenic
1184977980 22:48076587-48076609 AGAAATAACCTAAAAATAAGAGG - Intergenic
952760979 3:36913911-36913933 AGGAATAACTTAAAGTTGATGGG - Intronic
957342592 3:78920272-78920294 CAAAATAACATAAGGATTATAGG + Intronic
958049625 3:88328887-88328909 ATAAATAACCTAAGGAGTATGGG - Intergenic
958647787 3:96894767-96894789 AGAAATTGCTTAAGGATGAGTGG + Intronic
959275714 3:104275165-104275187 ATATATAACCTAAAGAAGATTGG + Intergenic
959438271 3:106344395-106344417 AGAAATACCTTAAGCATAATCGG + Intergenic
963550497 3:146716007-146716029 AAAAATAAGGTAAGAATGATAGG - Intergenic
964437692 3:156672034-156672056 AGCAACAAGCTAAGGATGCTGGG - Intergenic
964929553 3:162000616-162000638 AGAAATAACAGAAGGAAAATTGG + Intergenic
965613905 3:170573594-170573616 AATAATACCCTAAGGAAGATGGG + Intronic
966250353 3:177859076-177859098 AGACAGAACCTAAGGTAGATTGG - Intergenic
966440289 3:179937536-179937558 AGAAATAAAATTAAGATGATTGG - Intronic
967517835 3:190391459-190391481 AGAAATAAACGAAGTATCATTGG + Intronic
968210352 3:196843565-196843587 AGAAACAACCTAAGCATGTCCGG - Intergenic
968941061 4:3638096-3638118 AGAAAGAACCAAAATATGATAGG + Intergenic
970808493 4:20063656-20063678 ATAAATAAACAAAGAATGATTGG - Intergenic
972507600 4:39734980-39735002 GTAAATAACCCAAAGATGATAGG - Intronic
972970422 4:44567962-44567984 AGAAAACAGTTAAGGATGATTGG + Intergenic
975209000 4:71677295-71677317 AAAAATAACCACAGGATGCTGGG - Intergenic
975718938 4:77231738-77231760 ATAAATATCCTAAAGATCATAGG + Intronic
975969714 4:80018827-80018849 AGAAATAATCTATGGATCTTTGG - Intronic
978942263 4:114450434-114450456 AGAAATTACATAATGATGAAGGG + Intergenic
979266445 4:118708713-118708735 AGAAATAACCTAAGGATGATGGG + Intronic
980301360 4:130998579-130998601 AGATATAACTTAAAGAAGATTGG - Intergenic
981187175 4:141817209-141817231 AGATAGAACCTATGGTTGATTGG + Intergenic
981296825 4:143141869-143141891 AGACAAAACCTAAGTTTGATTGG + Intergenic
981324549 4:143430948-143430970 AGAAAAAGCCTAAAGATTATTGG - Intronic
982197123 4:152927791-152927813 AGAAATAACCTCAAGAAGGTTGG + Intergenic
983041869 4:162938406-162938428 AAAAACAAACTAAGGAAGATAGG - Intergenic
983307438 4:166009550-166009572 AGTAATAAACAAAGGCTGATTGG - Intronic
984967204 4:185149781-185149803 AGAAAATACCTAAAGGTGATTGG - Exonic
985526881 5:408513-408535 AGATATAATCCAAGGATGAAAGG - Intronic
986101419 5:4615180-4615202 AAAAATGAAATAAGGATGATTGG - Intergenic
986862100 5:11938420-11938442 TGAAATAAGTTAAGGAAGATTGG - Intergenic
989118999 5:37984664-37984686 AGAAATAACCTAGGGAATACAGG - Intergenic
991503238 5:67298363-67298385 TGAAATAGCCTAAGTATGAAAGG - Intergenic
992571852 5:78066673-78066695 AGACCTAACCTATGAATGATTGG + Intronic
995006120 5:107197849-107197871 AGAAATGATTTAAGGAGGATAGG + Intergenic
995052374 5:107720738-107720760 AGACTGAACCTATGGATGATTGG + Intergenic
995227497 5:109718120-109718142 AGAATTAAACTAAACATGATTGG - Intronic
995814566 5:116152745-116152767 AAAAATAACCAAAGGAAAATGGG - Intronic
996385144 5:122902725-122902747 AGCAATAACTTAAGCATGACAGG - Intronic
996391643 5:122968962-122968984 ATAAATAACCTAAATATGTTAGG + Intronic
996984593 5:129543845-129543867 AAAAATAATCCAAGTATGATAGG - Intronic
997022940 5:130023334-130023356 AGAAATTACATAAGGAAGAAGGG + Intronic
998893408 5:146770964-146770986 AGAATTTACCTATGCATGATGGG + Intronic
999597725 5:153223609-153223631 AAACATATCCTAAGGATGTTCGG + Intergenic
999845255 5:155472235-155472257 GAAAATAACCTAAGGTTCATTGG + Intergenic
1004220097 6:13739293-13739315 ACAAATAAGCTCAGGATGTTGGG + Intergenic
1005454991 6:26011202-26011224 ATTACTAACCTAAGGTTGATTGG + Intergenic
1006286408 6:33098019-33098041 TTAAATGACCTAAGAATGATTGG + Intergenic
1008019442 6:46559238-46559260 AGAAATGACCTAGGGAGGAAGGG + Intronic
1009851266 6:69202172-69202194 ACAAATACCCTAATGTTGATAGG + Intronic
1010947389 6:81992974-81992996 AGACAGAACCTAAGGAAAATTGG + Intergenic
1011373424 6:86665194-86665216 AAAAAAAACCTAAGAATAATTGG - Intergenic
1012678663 6:102151217-102151239 AAAAATAATCTATAGATGATTGG + Intergenic
1012751582 6:103169807-103169829 AAAATTAACATAAGGAAGATAGG - Intergenic
1012849939 6:104434565-104434587 AGAAAGAACCTTGGAATGATGGG - Intergenic
1013694535 6:112686675-112686697 AAAAACAACCTAATGATGAAAGG - Intergenic
1013758223 6:113485245-113485267 AGAACTAACCTTAGGAAGACTGG - Intergenic
1018527210 6:164726108-164726130 AGATATAACCCAACGGTGATTGG + Intergenic
1020523097 7:9220343-9220365 AGAATAAACCTAAAGAAGATAGG + Intergenic
1021374639 7:19890971-19890993 TGAAATAATATAAGGATGAGAGG - Intergenic
1023542153 7:41277032-41277054 TGAAATAAGCTTAGGATTATTGG + Intergenic
1023814588 7:43939837-43939859 AGAGATTACCTGAGGCTGATGGG + Intronic
1024056848 7:45665197-45665219 AGAAATAACCTAAATATCAATGG - Intronic
1024493423 7:50013959-50013981 AGAAATAGATAAAGGATGATAGG - Intronic
1024864089 7:53882869-53882891 AAAATAAACCTAAGGAGGATGGG + Intergenic
1028101334 7:86824398-86824420 ACAAATAAACTATTGATGATGGG - Intronic
1028931436 7:96417056-96417078 GGAAATAACCAAATGCTGATAGG + Intergenic
1030907157 7:115200136-115200158 AGAAATAACCTGATGATAAGTGG - Intergenic
1031472862 7:122188343-122188365 TGTAATTACTTAAGGATGATTGG - Intergenic
1031592293 7:123608580-123608602 AGAGAAATCCTAAGCATGATGGG - Exonic
1031936846 7:127743780-127743802 TGAAATAACCCAAGCCTGATAGG - Intronic
1033606412 7:142931306-142931328 CTAAATAACCTGAGGATGCTGGG - Intronic
1033793059 7:144815700-144815722 AGGAATAACTGAAGGAAGATAGG - Intronic
1037138873 8:15496029-15496051 AAAAATAAAATAAGGGTGATGGG - Intronic
1037176942 8:15958457-15958479 AGAAATATCTTGAGGATGACAGG - Intergenic
1038576244 8:28705341-28705363 AGAAATATGGTAATGATGATGGG + Intronic
1039033702 8:33336339-33336361 AGAAATAACCTCCAGAGGATAGG + Intergenic
1041072580 8:54139579-54139601 AGACAACACCTAAGGATGTTGGG - Intronic
1041747981 8:61230133-61230155 AGGAATAAACTAAGGTTGAGGGG + Intronic
1041960151 8:63605507-63605529 AGAAATCACCGGAGTATGATGGG - Intergenic
1042493611 8:69430979-69431001 AGAAATAATTTCAGGGTGATGGG + Intergenic
1044810077 8:96051461-96051483 AGAAATAATGTCAGGATAATTGG + Intergenic
1045257689 8:100542732-100542754 AGAAATAAATAAAGGATTATAGG + Intronic
1046353732 8:113050409-113050431 AGAAATAAATTATGGATGATTGG + Intronic
1048838782 8:138546695-138546717 AGAAATAATCTAGGGAGGAGAGG + Intergenic
1051234381 9:14983247-14983269 GGAAATAACCTACGCATGGTAGG - Intergenic
1051415063 9:16830849-16830871 AGGAATACCCTAAGGATTCTTGG + Intronic
1051429724 9:16969573-16969595 AGAAATAACCATAGAATCATTGG + Intergenic
1051820255 9:21157401-21157423 AGAAATAAAATAAGCAAGATGGG + Intergenic
1051873988 9:21771252-21771274 AGAAATAAGTTAAGGAAGAAAGG - Intergenic
1051901083 9:22041400-22041422 ATAAATAAGCTAGGGTTGATTGG - Intergenic
1053115699 9:35499903-35499925 AGAAACAACTTGAGGATGAACGG - Intronic
1056308154 9:85311898-85311920 AGAAGTAACCTAGGAATGACAGG - Intergenic
1057092734 9:92274248-92274270 AGAAATCAGCTTAGGATGAAAGG + Intronic
1058857520 9:109078043-109078065 ATAAATAGCCTAAGGATTAGGGG - Intronic
1059337842 9:113580342-113580364 AGGAATTACCTAAGAATGAGAGG - Intronic
1059554752 9:115268388-115268410 AGGAATAACCTAAGAAAGACGGG - Intronic
1062173914 9:135150308-135150330 AAATATAACCTAGGGATAATCGG - Intergenic
1185534919 X:853415-853437 AGAATTAACCTAAGTATCAGTGG + Intergenic
1188175919 X:26989052-26989074 AAAAATTACCTAAGTAAGATTGG + Intergenic
1190902554 X:54692171-54692193 AGACATAACTTAATGGTGATTGG + Intergenic
1191920781 X:66254923-66254945 AGAAAGATCCTAAAGAAGATGGG + Intronic
1193469771 X:81886426-81886448 TTAAATAACCTAAGAATAATTGG - Intergenic
1195781335 X:108468415-108468437 AGGAACAAACTAAGGATGCTTGG - Intronic
1196693779 X:118589355-118589377 AGAAGTAACCTAAGAGTCATTGG - Intronic
1197968906 X:132094407-132094429 AGAAACCACCAGAGGATGATTGG - Intronic
1199059461 X:143337223-143337245 ACAAAAAACCTAAGGAAGCTTGG - Intergenic
1202188568 Y:22216765-22216787 CAAAATTAGCTAAGGATGATGGG - Intergenic