ID: 979268691

View in Genome Browser
Species Human (GRCh38)
Location 4:118733873-118733895
Sequence GGTCATGTGAGCCAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979268691 Original CRISPR GGTCATGTGAGCCAAAGTGA GGG (reversed) Intronic
900478726 1:2888190-2888212 TGTCATGTGCCCCACAGTGAGGG + Intergenic
900695651 1:4008194-4008216 CTTCATGTGATCCAAGGTGAGGG - Intergenic
901119457 1:6878828-6878850 TGACATGTGTGACAAAGTGAAGG - Intronic
901383913 1:8894052-8894074 GGCCATGTGTGTCAAAGTCAGGG - Intergenic
903386725 1:22931804-22931826 GATCATGTGAGCCCAGGTCAAGG + Intergenic
903876252 1:26475421-26475443 GGCCATGTGTGTCAAAGTCAGGG - Exonic
904816487 1:33205396-33205418 GATCACGTGAGCCCAGGTGATGG + Intergenic
907889048 1:58620543-58620565 GGTCGTGTGATAGAAAGTGAAGG - Intergenic
908804714 1:67918341-67918363 GGCCATGTGTGCAGAAGTGAGGG - Intergenic
908827893 1:68151167-68151189 TGACTTGTGAGTCAAAGTGAGGG + Intronic
910320347 1:85936677-85936699 GGTCATGTGGCCCAAAGTACAGG - Intronic
914502721 1:148261612-148261634 GTTTACTTGAGCCAAAGTGAAGG - Intergenic
915336935 1:155149400-155149422 GGCCATGTGTGTCAAAGTCAGGG - Intergenic
917170880 1:172172656-172172678 GGTCATGTGACCAATAGAGAAGG + Intronic
918617179 1:186558779-186558801 GGCCAAGTTATCCAAAGTGATGG + Intergenic
919975152 1:202605628-202605650 GGACATGTTTGCCAAACTGAAGG - Exonic
921005667 1:211091153-211091175 GGTCATGTGAGTCAAATTGGTGG - Intronic
922341891 1:224664047-224664069 GGTGATGTCAGCCAGAGTGATGG + Intronic
924262709 1:242248659-242248681 GTTTACTTGAGCCAAAGTGAGGG - Intronic
1063293236 10:4773365-4773387 GGACATGTGAGGCACAGTGGTGG + Intergenic
1066725523 10:38388271-38388293 GTTTACTTGAGCCAAAGTGAGGG + Intergenic
1070378794 10:75860718-75860740 AGGCATGTGAGTCAAAGTGATGG + Intronic
1072546525 10:96443755-96443777 GATCATTTGTGGCAAAGTGAAGG + Intronic
1075677349 10:124304538-124304560 GGGGATGTGAACCAACGTGAAGG - Intergenic
1075739292 10:124684086-124684108 GGTCATGAGATACAAACTGAGGG + Intronic
1078454711 11:11465940-11465962 GTGGATGTGAGCCAAAGTCAGGG + Intronic
1079160799 11:17992001-17992023 GGCAATGTGGGCCAAAGAGAAGG + Intronic
1080935574 11:36859302-36859324 TGGGATGTGAGCAAAAGTGATGG - Intergenic
1082986304 11:59173197-59173219 GGTCAGGTCAGCCAAGGTGCCGG - Intronic
1084655434 11:70513236-70513258 GGCCATAGCAGCCAAAGTGAGGG + Intronic
1085074734 11:73580784-73580806 GGCCATGTGTGTCAAAGTCAGGG - Intronic
1085216249 11:74835408-74835430 GGTAATGTGAGCCTAAGAAATGG - Intronic
1085323557 11:75589560-75589582 GGTCATGAGAGGACAAGTGATGG + Intronic
1085546449 11:77322727-77322749 GATCAGCTGAGCCAAAGTCATGG + Intronic
1085646031 11:78223508-78223530 AGCCAAGTGAGTCAAAGTGATGG + Exonic
1087349593 11:97014870-97014892 GCTCATGTAAACCAAAGTTATGG + Intergenic
1087487203 11:98771145-98771167 TGTCATGTGTGACAAAGTGGAGG + Intergenic
1088019407 11:105101291-105101313 GTTTATGTGAGCAAAAGTGAGGG - Intronic
1088429029 11:109737072-109737094 GGTCATTTGAGGCAAGGAGAGGG + Intergenic
1089761326 11:120726233-120726255 GGTCTTGTAAGCCATAGTGGAGG + Intronic
1093728322 12:22541294-22541316 GGTAATGTTATCCAAGGTGATGG - Intronic
1096256672 12:50066175-50066197 GATCACGTGAGCTAAAGTAAAGG - Intronic
1097138748 12:56881299-56881321 AGTCAGGTCAGCCAAAGTGAAGG - Intergenic
1097347143 12:58505986-58506008 GGTTAAGGGAGACAAAGTGAAGG - Intergenic
1097934584 12:65231461-65231483 GATCATGTGAGCCCAGGTGGTGG + Intronic
1101208326 12:102511435-102511457 TGTCATCTGAGCCAGAGTGTAGG - Intergenic
1102955099 12:117054048-117054070 TGTCATGTGTGCCAAAGAGGAGG - Intronic
1105648249 13:22344684-22344706 GGTGATGTCAGCCAGAGAGAAGG + Intergenic
1108763213 13:53595160-53595182 GCTCATGTGGGAAAAAGTGAAGG + Intergenic
1109998608 13:70164574-70164596 TGTCATCTGAGCATAAGTGAAGG + Intergenic
1112917492 13:104569503-104569525 TGTCATGAGAGCCAGAGTTATGG - Intergenic
1114034070 14:18605121-18605143 GGCCATGTAAGCCAAAGAGCTGG + Intergenic
1114511291 14:23263616-23263638 GGCCATGTGTGTCAAAGTCAGGG + Intronic
1115478703 14:33840942-33840964 GGCCATGTGAGGCACTGTGAGGG - Intergenic
1115758129 14:36549895-36549917 GGTCATGGGTCCCACAGTGATGG + Intergenic
1123834974 15:24180213-24180235 GGTCATGTGAGACACAGAGGAGG + Intergenic
1123844290 15:24281782-24281804 GGTCATGTGAGCCACGGAGGAGG + Intergenic
1123863719 15:24495408-24495430 GGTCATGTGAGCCACGGAGGAGG + Intergenic
1124445857 15:29731255-29731277 GGCCATGTGTGTCAAAGTCAAGG - Intronic
1124490809 15:30153966-30153988 GGACATGTTTGCCAAACTGAAGG - Intergenic
1124752723 15:32384363-32384385 GGACATGTTTGCCAAACTGAAGG + Intergenic
1125631979 15:41154636-41154658 GGTCATGTGAGTCAGTGTAAAGG - Intergenic
1125828634 15:42695590-42695612 GGGCATGTGAGGCTAAGTCAGGG + Intronic
1127663125 15:61119105-61119127 AGTCGTGTGAGCCAAGGTGCAGG + Intronic
1135618481 16:23932693-23932715 GGTCATGTGGACCAGAGGGATGG + Intronic
1135858297 16:26032246-26032268 GGCCATGTGTGTCAAAGTCAGGG + Intronic
1136564843 16:31063705-31063727 GGTAAAGTGAGCCAATGGGAAGG - Intronic
1137062331 16:35802619-35802641 GGCCATGTGTGTCAAAGTCAGGG + Intergenic
1137931084 16:52588334-52588356 GGTCATGAGATAGAAAGTGATGG - Intergenic
1139891296 16:70254674-70254696 TGTCATGGAAGCCAAAGTGAAGG - Exonic
1141091130 16:81130989-81131011 CGTCAAGTGATCCAAAGTGCTGG - Intergenic
1141363163 16:83416399-83416421 GGTCATGAGAGTCAAAAAGAAGG - Intronic
1143858005 17:9866783-9866805 GGTCATATGACCAAAAATGAAGG - Intronic
1147753569 17:42753240-42753262 GGCCATGTGTGTCAAAGTCAGGG + Intergenic
1148232646 17:45946251-45946273 GGTTGTGTGAGACAAACTGATGG - Intronic
1148537559 17:48453096-48453118 GCTCAAGTGACCCAAAGTGCTGG + Intergenic
1151796015 17:76346357-76346379 GGCCATGTGTGTCAAAGTCAGGG - Intronic
1152025674 17:77807452-77807474 GGTCACGTGTGACCAAGTGATGG + Intergenic
1153316346 18:3726407-3726429 GATCATGTGAGAAAAAGAGAAGG + Intronic
1155339687 18:24801402-24801424 GGATATGTGACCCAAAGTGAAGG + Intergenic
1157231662 18:45922436-45922458 TGTCATGTCAGGCACAGTGACGG + Exonic
1157794975 18:50564971-50564993 GGTCCTGTGAGGACAAGTGATGG + Intronic
1158497947 18:57973750-57973772 GGACATGTGAGCCACCTTGAAGG - Intergenic
1159142072 18:64409427-64409449 GGTTACGTGAGCACAAGTGAAGG + Intergenic
1159944294 18:74432348-74432370 GGTGATGTGAGCCATGGGGAGGG - Intergenic
1162835651 19:13315882-13315904 GGGCCTGTGAGCCAAAGCCAGGG + Intronic
1163759700 19:19129352-19129374 GGTCATGTGGGCCATGGTGAGGG + Intronic
1166376590 19:42330920-42330942 GGTGATTTGAGACAAAGCGAGGG + Intronic
1167876650 19:52419585-52419607 GGTCATTTGAGCCCAAGAGTTGG - Intergenic
925582710 2:5427598-5427620 GGTCATGTCATCCAATGTCAAGG + Intergenic
927029853 2:19109604-19109626 GCTCATCTGAGCCAAAAGGAAGG + Intergenic
927136650 2:20101782-20101804 GGTCATGTGAGCCACAGGTCCGG - Intergenic
931458135 2:62427987-62428009 GTTTATTTGAGCCAAAGTGAGGG - Intergenic
934035981 2:88088783-88088805 GGGGATGTGAGCCAGAGAGAGGG + Intronic
935168456 2:100590452-100590474 GGTCATGTGTGTCAAAGTCAGGG + Intergenic
940786527 2:157987597-157987619 GATCATGTGAGCCCAAGAGGAGG + Intronic
943204673 2:184878254-184878276 GATTATGTGAGCCAAAGAGTAGG + Intronic
948527723 2:238582460-238582482 GGTGATGTGAGCACAAGTCAAGG - Intergenic
1172018873 20:31898594-31898616 GGACCTGTGAGACAAAGGGAAGG - Intronic
1173116291 20:40246607-40246629 TGTCATGTCTGCCAAAGGGATGG + Intergenic
1173960913 20:47071901-47071923 GGTCACGTGAGCCATAGCCACGG + Intronic
1175294630 20:57899956-57899978 GGTCACATGAGCCACAGCGAGGG - Intergenic
1175370485 20:58485575-58485597 GGTGACTTGAGCCAGAGTGATGG - Intronic
1175391623 20:58631318-58631340 GGTCATCTGGGCCACTGTGAAGG - Intergenic
1180458187 22:15532164-15532186 GGCCATGTAAGCCAAAGAGCTGG + Intergenic
1180632927 22:17242101-17242123 GGTCATGTGTCCCTAAGTGCGGG - Intergenic
1183672580 22:39281765-39281787 GGTCTTGTGGGCTAAAGTCAAGG - Intergenic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
950577594 3:13842090-13842112 GGGCCTGTGAGCCACCGTGAAGG + Intronic
950778964 3:15374774-15374796 GGCCATGTGTGTCAAAGTCAGGG + Intergenic
951740197 3:25912985-25913007 GGTCATGTGAGCCACTCTGGGGG + Intergenic
953096617 3:39782976-39782998 CATCAAGTGGGCCAAAGTGACGG - Intergenic
955143321 3:56291311-56291333 GCTAATGTGAGCCAAAGGGTTGG - Intronic
958411657 3:93824539-93824561 GGTTAAGTTGGCCAAAGTGAAGG - Intergenic
958922587 3:100123352-100123374 GGTATTGTGAGCCAAAGAGGAGG + Intronic
961060519 3:123824535-123824557 TGTCATGTTAGCCACATTGATGG + Intronic
962535774 3:136327717-136327739 AGTCATGGGAGCAAAGGTGAGGG + Exonic
963874679 3:150462179-150462201 GGTCATAAGAGCCAGAGGGAAGG + Exonic
964108798 3:153067812-153067834 GGCCATGTGTGTCAAAGTCAGGG - Intergenic
964986799 3:162752259-162752281 AGTTATGTGAGCAAAAGTTAAGG - Intergenic
967220624 3:187245314-187245336 GGTCAGGTGGACCAAAGTTAAGG - Intronic
970785985 4:19796882-19796904 GGACATGTCAGGCAAAGAGAAGG + Intergenic
976474797 4:85471836-85471858 AATCATGTGATCCAAAGTGTTGG + Intergenic
976903660 4:90209250-90209272 GGTCATGAGAGCCCAAGTGAGGG + Intronic
977914890 4:102580441-102580463 GGTCATGTGTGCTAAGGGGAGGG + Intronic
978464326 4:108992349-108992371 GGTTATTTGGGCCAAAGTCATGG + Intronic
979268691 4:118733873-118733895 GGTCATGTGAGCCAAAGTGAGGG - Intronic
981666075 4:147228117-147228139 GGTCATTTGAGCCAGAGTTTAGG + Intergenic
987111145 5:14688231-14688253 GGTCATGTAAGCCAGTGTGCAGG - Intronic
987645113 5:20660581-20660603 GGTCATGTGACCCAGGGTCAGGG - Intergenic
989767210 5:45101698-45101720 TGTCATGTGAGTCAAAGTTTAGG + Intergenic
990204165 5:53410861-53410883 GGACATATGAGCCAAAATGAAGG + Intergenic
990689103 5:58342829-58342851 GGACATGAGAGCCAAATTGAAGG + Intergenic
992101365 5:73410695-73410717 GGCCATGTGTGTCAAAGTCAGGG - Intergenic
992381457 5:76241728-76241750 GGCCATGTGTGTCAAAGTCAGGG + Intronic
995199754 5:109412848-109412870 AGTGATGTCAGCCAAAATGAAGG + Intergenic
995294045 5:110497795-110497817 GGTCATATAAGATAAAGTGAAGG + Intronic
997313297 5:132909230-132909252 AGTCATTTGAGCCCAAGAGATGG - Intronic
998934669 5:147221888-147221910 GGTCATGATAGCAGAAGTGAGGG - Intergenic
1001058911 5:168471620-168471642 AATCATGGGAGCCAAAGGGATGG - Intronic
1002974256 6:2058736-2058758 TGTCATGTGAGTCAGAGCGACGG + Intronic
1002982875 6:2159304-2159326 GATCATGTGAGCCCAAGAGTAGG - Intronic
1003326692 6:5097414-5097436 GCTCATGGCAGCTAAAGTGATGG + Intergenic
1004305631 6:14499574-14499596 GGTGATGCGAGCAAAGGTGATGG - Intergenic
1004560296 6:16743411-16743433 GGTCCTGTGAACCACAGTGGTGG - Intronic
1008687035 6:53936817-53936839 GATCATGTGAACCACAGTGTTGG + Intronic
1008916267 6:56790875-56790897 GGTCTTGTTGGCCAAAGTGTGGG - Intronic
1009239700 6:61169282-61169304 GGTGATGTGAGTCAAGGTGTGGG + Intergenic
1010727704 6:79354164-79354186 GGCCATGTGTGTCAAAGTCAGGG + Intergenic
1012136511 6:95563821-95563843 GTTCATGACAGCTAAAGTGAAGG + Intergenic
1014434770 6:121409081-121409103 GGCCATGTGTGTCAAAGTCAGGG - Intergenic
1017054265 6:150423889-150423911 GGGCATGTGGGCCACAGTGGGGG - Intergenic
1021497718 7:21294298-21294320 TGTCATGAGAGACGAAGTGAAGG + Intergenic
1025978824 7:66391341-66391363 GGTCATGTGAGCGATGGGGAGGG + Intronic
1026060310 7:67019659-67019681 GTTTATTTGAGCCAAAATGAGGG + Intronic
1026315062 7:69220723-69220745 GGTAATGTGAGCCATGGGGATGG + Intergenic
1026409873 7:70108943-70108965 GGGCTTGGGAGCCAAACTGAAGG - Intronic
1027139161 7:75644930-75644952 TCTCATTTGAGTCAAAGTGAAGG - Intronic
1027204412 7:76086049-76086071 GGTCATGTGAGCAATGGGGAGGG + Intergenic
1030184265 7:106745421-106745443 TGTCTGGTGAGCCAAAGAGAAGG + Intergenic
1032079978 7:128853945-128853967 GGTCAAGGGAGCCAGGGTGAGGG - Intronic
1032855907 7:135833291-135833313 GGTCATGTCAGACAAAAGGAAGG + Intergenic
1035791708 8:2312130-2312152 GGTCATGTGAGCGATGGGGAGGG + Intergenic
1035801097 8:2409575-2409597 GGTCATGTGAGCGATGGGGAGGG - Intergenic
1038402814 8:27298366-27298388 GGTTATGTGAGCCAAAGCCACGG + Intronic
1039079820 8:33723082-33723104 GGTCAGGTGGGCCAGAGGGAAGG + Intergenic
1039862241 8:41468918-41468940 GGTCATCTGAGCAGAAGGGAGGG - Intergenic
1039892608 8:41695291-41695313 GGCCATGGGAGGCAAAGTGCGGG + Exonic
1045594758 8:103640211-103640233 TGTCATGTGATCAGAAGTGATGG + Intronic
1048903482 8:139063465-139063487 GGTAAGGTAAGCCAAAGTGAAGG - Intergenic
1051262629 9:15279756-15279778 GGACATGTCAGCCACAGAGAAGG - Intronic
1051509018 9:17856971-17856993 GGCGATGTGAGACAAAGAGAAGG - Intergenic
1051802440 9:20951270-20951292 GGTCATGTGACAGTAAGTGATGG + Intronic
1052223860 9:26060396-26060418 GGCCATGACAGCAAAAGTGAGGG - Intergenic
1054484625 9:65709061-65709083 GGTCTTGTAAGCCAAAGGAATGG - Intronic
1055206750 9:73740154-73740176 GATAAGGTGAGCTAAAGTGAGGG + Intergenic
1187938003 X:24354511-24354533 GGCCATGTGTGTCAAAGTCAGGG - Intergenic
1190157558 X:48006097-48006119 GTGGATGTGGGCCAAAGTGAGGG + Intronic
1190173328 X:48128982-48129004 GTGGATGTGGGCCAAAGTGAGGG + Intergenic
1190259419 X:48788631-48788653 GGTCATGTAAGCAGGAGTGAGGG + Intronic
1192992397 X:76474321-76474343 TGTCATCTGAGCCAAACTGAAGG + Intergenic
1193010334 X:76668607-76668629 GTTCTTGTGAACCAAAGTAAAGG - Intergenic
1194857773 X:98955945-98955967 AGTAATATAAGCCAAAGTGAGGG - Intergenic
1195713560 X:107796024-107796046 GGAAATGTGAGCAAAAGTGACGG - Intergenic
1197622867 X:128770749-128770771 GGTGATGGGAGACAAAATGAGGG - Intergenic
1198437364 X:136630255-136630277 GGTGAGGCGAACCAAAGTGAAGG + Intergenic
1199416996 X:147596873-147596895 GTTCATGTCAGCAAAAATGATGG + Intergenic
1199999597 X:153051861-153051883 GGCCATGTGTGTCAAAGTCAGGG + Intergenic
1200739349 Y:6836369-6836391 GATTTTGTGAGCCAGAGTGAAGG + Intergenic
1201682700 Y:16666428-16666450 GATGATGTGGGTCAAAGTGATGG - Intergenic