ID: 979270676

View in Genome Browser
Species Human (GRCh38)
Location 4:118756991-118757013
Sequence CACAGCCCAAAACAAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979270676_979270677 5 Left 979270676 4:118756991-118757013 CCTGAAATTTGTTTTGGGCTGTG 0: 1
1: 1
2: 1
3: 8
4: 207
Right 979270677 4:118757019-118757041 GTGTAACTTTATATTTCTTATGG 0: 1
1: 4
2: 4
3: 34
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979270676 Original CRISPR CACAGCCCAAAACAAATTTC AGG (reversed) Intronic
900907723 1:5572478-5572500 CACTGCCCAAGACAACTTCCTGG - Intergenic
903173000 1:21565165-21565187 CACTGCCCCCCACAAATTTCTGG + Intronic
904881684 1:33702855-33702877 CATATCCCAAAATAAATTCCAGG - Intronic
907533285 1:55123813-55123835 CACAAGGCAAAACTAATTTCAGG + Intronic
908117592 1:60955060-60955082 CTCAGCCCAGCACAAAGTTCTGG - Intronic
910805389 1:91185123-91185145 CACAACAGAAAAAAAATTTCAGG - Intergenic
911210804 1:95136234-95136256 CACAAAAAAAAACAAATTTCAGG - Intronic
916145393 1:161734660-161734682 CACAGAACAAATCTAATTTCTGG + Intergenic
918093712 1:181317834-181317856 CACAGTGGAAAAGAAATTTCTGG - Intergenic
919774025 1:201182050-201182072 CATAGCCCCAAATAAATTTGGGG - Intergenic
921653457 1:217706277-217706299 CACTGCCCAAAGCAATTTACAGG - Intronic
921684754 1:218077009-218077031 CACTGCCAAAAGCAGATTTCAGG + Intergenic
921967100 1:221101823-221101845 CATATCCCAAAAAAAATTTCTGG - Intergenic
923014159 1:230112940-230112962 CAGAGCCCAGAACAAAATCCAGG - Intronic
1064093583 10:12406305-12406327 CAAACACCAAAACAAATTCCAGG + Intronic
1064457128 10:15498289-15498311 AACTGCCCAAAACAAATTAGAGG - Intergenic
1065068806 10:22001452-22001474 CACAGGTTAAAACAATTTTCTGG + Intronic
1068436720 10:57001952-57001974 CACAGACAAAAACAAATAACAGG + Intergenic
1069577244 10:69539670-69539692 ATCAGCCCCAAACTAATTTCTGG - Intergenic
1070430190 10:76330195-76330217 CACAGCCCATAACAAAAGACAGG + Intronic
1070512218 10:77171852-77171874 CCCAGCCCAAAGAAGATTTCAGG - Intronic
1070957967 10:80476899-80476921 CAAAGCCCAAATCAAATTGTTGG + Intronic
1073063009 10:100743467-100743489 CACACCCCGAGACAAATTCCTGG + Intronic
1073793546 10:106963413-106963435 AACAATCAAAAACAAATTTCTGG - Intronic
1075262507 10:120975515-120975537 CACAGCGTAACACAAAGTTCAGG + Intergenic
1076144501 10:128106560-128106582 CACAGCCCAAGAGAAGTCTCAGG - Exonic
1076314912 10:129533163-129533185 CACAGCCAAAATCAAGCTTCAGG - Intronic
1076406039 10:130213136-130213158 CACAGCCCCAGAGAAAGTTCAGG - Intergenic
1080781294 11:35432257-35432279 CACAGGCCAAATCACACTTCAGG + Exonic
1081267776 11:41048191-41048213 CACATCCCAACACACATTGCTGG - Intronic
1087671737 11:101114894-101114916 CACTGCCCAAAAAATATTTAGGG + Intronic
1088236890 11:107734614-107734636 TACTGCCCAAAACAATTTGCAGG - Intergenic
1092264713 12:6971706-6971728 CACATCCCAAGACAAGTTACTGG + Intronic
1093274688 12:17109727-17109749 CACAGCTCAGAACAATTTTGAGG - Intergenic
1093333488 12:17871580-17871602 CACAACACACAAAAAATTTCAGG + Intergenic
1094626330 12:32127876-32127898 CACAGCCCCAATAAGATTTCTGG - Intronic
1095685446 12:45028361-45028383 CAGAGTCTAAAACAAATTTATGG + Intronic
1095755008 12:45755128-45755150 CACAGTCTAAAACCAATTTTTGG - Intronic
1095865719 12:46969865-46969887 CTCAGCCCAAAGCAAAATTTTGG + Intergenic
1096081658 12:48837318-48837340 CCCACTCAAAAACAAATTTCCGG + Exonic
1096408457 12:51360506-51360528 GACAGCTCAAAACAAACTACTGG - Intronic
1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG + Intergenic
1098070487 12:66669067-66669089 CCAAGCCCAAAACAAATGTGTGG + Intronic
1100617874 12:96245329-96245351 CACATCCCCACACAAATTTAGGG - Intronic
1100839884 12:98602119-98602141 GACAGCTGAAAACAATTTTCAGG + Intronic
1104119426 12:125784842-125784864 CACTGCTAAAAATAAATTTCTGG + Intergenic
1104211105 12:126689557-126689579 CACAGCCCATAGCAAATATAGGG + Intergenic
1105672853 13:22639765-22639787 TACAGACGAAAACAAATTTGAGG + Intergenic
1108228480 13:48315110-48315132 CACTGCCCAAAGCAATTTACAGG - Intronic
1108687515 13:52833603-52833625 CACAGCTAAAAAGAAATGTCAGG - Intergenic
1110074689 13:71224927-71224949 CATAGCCCAAAATTTATTTCTGG - Intergenic
1111079538 13:83284934-83284956 CAAACCCAAAGACAAATTTCAGG - Intergenic
1111282343 13:86043117-86043139 CACAGCCCAAACCAACATTATGG - Intergenic
1112375288 13:98834221-98834243 CACAGAGGAAAACAAATCTCGGG + Intronic
1112523677 13:100121962-100121984 CAGAGCCTAAATCAAATTTAAGG - Intronic
1112965464 13:105186716-105186738 CACACACAATAACAAATTTCTGG - Intergenic
1114080080 14:19196215-19196237 CATGGCCCAAACCAATTTTCAGG - Intergenic
1114969982 14:28014009-28014031 CACAACCCAAACCAAATTTTTGG - Intergenic
1118006123 14:61565371-61565393 CACAGCCCTGGACAACTTTCAGG - Intronic
1118725740 14:68627948-68627970 CACAACCCAAAACAAAAGCCAGG + Intronic
1118749737 14:68796839-68796861 TACACCACAAAACAAATTCCGGG + Intergenic
1123854857 15:24398392-24398414 CACTGCCCAAAAGAAATCTTTGG - Intergenic
1123870887 15:24571378-24571400 CACTGCCCAAAAGAAATCTTCGG - Intergenic
1124871067 15:33543264-33543286 TACACCCAATAACAAATTTCTGG - Intronic
1126450020 15:48796872-48796894 CACCACCCATAACAAATTTTAGG - Intronic
1127405720 15:58643520-58643542 CACTGCACAAAGCAAATTTTAGG + Intronic
1128448735 15:67788278-67788300 CTGAGGCCAAATCAAATTTCTGG - Intronic
1131608121 15:93931088-93931110 CACAGCAAAATACAAATTTTAGG - Intergenic
1132410553 15:101575301-101575323 CACACCCAAAAGCAAATTCCAGG + Intergenic
1133713142 16:8420810-8420832 CACAGCCCAAGACAATGTCCAGG + Intergenic
1135826249 16:25731126-25731148 CAGACCCCCAATCAAATTTCGGG - Intronic
1138426970 16:56941269-56941291 CACAGCTAAAACCAAATGTCAGG - Intronic
1138746290 16:59366911-59366933 CACAGCCCAAACCCAATTGGAGG - Intergenic
1138876982 16:60964136-60964158 CTCAGCTCAAAATAGATTTCTGG - Intergenic
1141004627 16:80340363-80340385 CACAGCCCAAATCCTCTTTCAGG - Intergenic
1141903472 16:87007628-87007650 CACAGACCAGATCACATTTCTGG + Intergenic
1145000862 17:19303653-19303675 CACAGCACAAAATAACTTTGTGG + Intronic
1150114228 17:62530848-62530870 CACAGCCAAAAATACCTTTCAGG - Intronic
1150967615 17:69989619-69989641 CACAGCCCCCAACAAATTTCGGG - Intergenic
1153474165 18:5479335-5479357 CAAAGCCCTAAACAGAATTCTGG - Intronic
1156028077 18:32679795-32679817 TACAGCAGAAAACAATTTTCTGG + Intronic
1156318024 18:35989288-35989310 CACTGCTCTAAACAAATTCCAGG - Intronic
1157369159 18:47094464-47094486 CAGAGCCCAACACAAATTAATGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160613521 18:80107600-80107622 CTGAGCCCAAAACAGATTTTAGG - Intergenic
1161407420 19:4098389-4098411 CACACCCCACAACTCATTTCAGG - Intronic
1162215323 19:9129170-9129192 CACAAACAAAAACAAAATTCAGG + Intergenic
1163867348 19:19785287-19785309 CACACCACAAAACAAATAACGGG + Intergenic
1168213078 19:54905929-54905951 CTCAGCCCAAAATGCATTTCTGG - Intergenic
925157462 2:1658598-1658620 CACAGCCCAAGCCAAATCTTAGG + Intronic
925990382 2:9249864-9249886 ACCAGCCCAAAACAAAAATCTGG - Intronic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
930031773 2:47062540-47062562 CACTGCCCTAATCAAGTTTCTGG - Intronic
935745269 2:106184879-106184901 CACACCACAAAGCACATTTCAGG + Intronic
937133492 2:119531249-119531271 CACAGCAGAAAAAAAAATTCTGG + Intergenic
938086558 2:128405792-128405814 CACTGCCCAAATCACATTGCTGG - Intergenic
938675273 2:133626928-133626950 CACATACCAAAATAAATTTCCGG + Intergenic
939075203 2:137593010-137593032 CACAGCCCAAAAGAACTGTGTGG - Intronic
940646865 2:156400748-156400770 CCCAGCCGAAAGCATATTTCTGG - Intergenic
941210709 2:162635119-162635141 CACTGTCCAATAGAAATTTCTGG - Intronic
941704847 2:168647104-168647126 CACTGCCCAAATCAATTTACCGG - Intronic
941722308 2:168824923-168824945 CCCAACACAAAACAAATTTAGGG - Intronic
942973623 2:181987719-181987741 CACATGCAAAAGCAAATTTCTGG - Intronic
943051368 2:182917242-182917264 CACAGCCTCAAACAAATCTGGGG - Intronic
944355792 2:198786274-198786296 CACAACGAAAAAAAAATTTCAGG - Intergenic
944673670 2:202016979-202017001 CACTGGCCAAAACACAGTTCTGG - Intergenic
944978129 2:205081275-205081297 CACAGAAAAAAATAAATTTCAGG - Intronic
945632095 2:212291197-212291219 CACAGCCCATGACAAGTTTAAGG + Intronic
946884447 2:224209256-224209278 AACAACAAAAAACAAATTTCAGG + Intergenic
947883825 2:233546276-233546298 CACAACCCAAAAGAAATTCAAGG + Intronic
948703153 2:239773326-239773348 CACAGCCGTAAACACATTGCAGG - Intronic
1169951272 20:11046186-11046208 CAGAGACCAAAGCAATTTTCGGG - Intergenic
1177190994 21:17850726-17850748 CACAAGCCAAAAAAAATCTCTGG - Intergenic
1177793379 21:25745108-25745130 CCCAAACCAAAACACATTTCTGG - Intronic
1180500694 22:15926485-15926507 CATGGCCCAAACCAATTTTCAGG + Intergenic
1183073876 22:35414235-35414257 CAAAGCCCACAGCCAATTTCTGG - Intronic
1183822752 22:40360009-40360031 CACAGCCCAATAGAAATGCCTGG - Intronic
1185180387 22:49356956-49356978 CACAGCACAAACCAGACTTCGGG - Intergenic
949330954 3:2921432-2921454 AACAGGCCAAAAGAAATTTGGGG + Intronic
950368984 3:12511495-12511517 CATAAACCAAAATAAATTTCAGG + Intronic
952559783 3:34577932-34577954 AACAACTCAAAACCAATTTCAGG - Intergenic
952916486 3:38248979-38249001 CACAGCTAAAAGCAAATTTCAGG + Intronic
954007886 3:47607367-47607389 CACAACCCAAAATATATTTTAGG - Intronic
954702698 3:52459194-52459216 CATAGCCCAAAACTAATTAAGGG + Intronic
956792315 3:72689653-72689675 CACAGCCCAGAGCTAATTGCAGG - Intergenic
959384248 3:105682371-105682393 CACTGCCAAGAACAAAATTCTGG + Intronic
961202927 3:125058623-125058645 GACAGCCCAGAACAAATTCCAGG + Intergenic
962302590 3:134255921-134255943 CACTGCCCAATAGAAATGTCAGG - Intergenic
963308566 3:143681975-143681997 CACAACCCAAACCACTTTTCAGG + Intronic
966252445 3:177881380-177881402 AACAAACCAAAAGAAATTTCAGG - Intergenic
966405070 3:179588397-179588419 AACAGTCCAAAATATATTTCTGG - Exonic
966481482 3:180413712-180413734 CACAGCCCTAAAAAAATCTGGGG + Intergenic
967667626 3:192191869-192191891 CAAAGCCCTAAACAAATAGCAGG + Intronic
968220451 3:196934162-196934184 CACAGCCAAAAACATAATTTGGG - Exonic
973841087 4:54861356-54861378 CACAGGGCAAAACAAAGTCCAGG - Intergenic
974281496 4:59800829-59800851 TACAGCCCAAAACAATTTATAGG - Intergenic
976875217 4:89846293-89846315 CACAACTAAAAATAAATTTCTGG + Intergenic
978515777 4:109567213-109567235 CACTGCCCAAATCACATTTCTGG + Intronic
979270560 4:118755766-118755788 CACAGCCCAAAATAAATTTCAGG + Intronic
979270676 4:118756991-118757013 CACAGCCCAAAACAAATTTCAGG - Intronic
980588928 4:134857551-134857573 CACAGGGGAAAACATATTTCAGG + Intergenic
981282856 4:142979610-142979632 CACAACCTCTAACAAATTTCTGG - Intergenic
981522059 4:145672970-145672992 CAGAACCAAAAATAAATTTCAGG + Intergenic
981757996 4:148162191-148162213 CAGAGACAATAACAAATTTCTGG + Intronic
982353004 4:154436571-154436593 CATACTCCAAAATAAATTTCTGG - Intronic
982444264 4:155471756-155471778 CACAGCACAAAGCAAGGTTCTGG + Intergenic
984303196 4:177950816-177950838 CACAGTCCATAACAAATTAAAGG - Intronic
987568307 5:19622509-19622531 CACAGGCCAGCACAAATTTAAGG - Intronic
987663068 5:20902857-20902879 AACAAAACAAAACAAATTTCTGG - Intergenic
988759616 5:34299325-34299347 AACAAAACAAAACAAATTTCTGG + Intergenic
990626614 5:57620011-57620033 CACACACAAAAACAAATTTCAGG + Intergenic
991183657 5:63783796-63783818 GTCAGCCCAAGACAGATTTCTGG + Intergenic
991186236 5:63811650-63811672 CAAAGCCCAACACAAAGTCCTGG - Intergenic
992918400 5:81483991-81484013 CACTGCCCAATAGAACTTTCTGG - Intronic
993212537 5:84971336-84971358 CAAAACTCAAAACTAATTTCTGG - Intergenic
993653284 5:90548027-90548049 CACAGCCCACAGAATATTTCTGG + Intronic
994102295 5:95907308-95907330 TACAGGCCAAGACAAATTTTAGG + Intronic
994719493 5:103364708-103364730 CACAGAGCAACACAAGTTTCAGG + Intergenic
995577919 5:113561096-113561118 AACAGACGAAAACAAATTCCAGG - Exonic
997575634 5:134974814-134974836 CACAGTCCATAACCAATCTCTGG - Intronic
1002147176 5:177193575-177193597 GACAGCTCAAATCAAGTTTCAGG - Intronic
1002260296 5:177989055-177989077 CACATAGCAAAATAAATTTCAGG + Intergenic
1002886163 6:1296274-1296296 CACAGCTCAGAACCACTTTCGGG + Intergenic
1003034621 6:2632186-2632208 AACACTCCAAAACAACTTTCAGG + Intronic
1004421884 6:15477957-15477979 AACAGCCCACAACATAGTTCTGG - Intronic
1004678328 6:17866261-17866283 CAAAGCCCAAACCAAATATAAGG + Intronic
1008043477 6:46827897-46827919 CACAGCCCAGAAGAAAGATCTGG + Intronic
1009774576 6:68189568-68189590 CAGAACCCAAAACACACTTCAGG + Intergenic
1010880307 6:81159891-81159913 AACACCTCAAAACAAATTTTGGG - Intergenic
1011541245 6:88432631-88432653 CCCATCCTGAAACAAATTTCTGG + Intergenic
1011891716 6:92171327-92171349 TACAGCGTAAAACAAAATTCTGG - Intergenic
1012617562 6:101295461-101295483 CAAAGTCAAACACAAATTTCAGG - Intergenic
1014993708 6:128114767-128114789 CACAGAGCAAAACATATTACAGG + Intronic
1015201490 6:130586432-130586454 GAAACCCCACAACAAATTTCTGG + Intergenic
1015390574 6:132677007-132677029 CACAGGCCAAAGCATATTTGGGG - Intergenic
1016365500 6:143313043-143313065 GACAGCCAATAACAAATGTCGGG + Intronic
1017377368 6:153786882-153786904 AAGAGATCAAAACAAATTTCTGG + Intergenic
1017522946 6:155218305-155218327 CACACCCCAAACCATTTTTCAGG - Intronic
1017525726 6:155240049-155240071 CACAGCCCAAGAGCAATTACAGG - Intronic
1017638281 6:156465183-156465205 CACAGCTCAAAACACTTGTCTGG - Intergenic
1022447078 7:30479245-30479267 CACTGCCAAGAACAAATTTAAGG - Intergenic
1028274684 7:88840131-88840153 CACTGACCAGAACAAAGTTCTGG + Intronic
1028476113 7:91255176-91255198 CACAACAAAAAAAAAATTTCAGG - Intergenic
1028669376 7:93383653-93383675 CACAGCCGGAAACAAAGTTCGGG + Intergenic
1028967896 7:96823111-96823133 CACAGCCCAAGAATAATTTTGGG + Intergenic
1032043932 7:128586617-128586639 CACAGCCAAAAATACCTTTCAGG - Intergenic
1033837064 7:145327922-145327944 CACAGTCCACAACTCATTTCTGG + Intergenic
1034305867 7:150044638-150044660 CACACCCCAAATAAAATTTATGG - Intergenic
1034800974 7:154056015-154056037 CACAACCCAAATAAAATTTATGG + Intronic
1035495530 7:159322342-159322364 CACAGAACAAAAAAAAATTCAGG + Intergenic
1035733745 8:1872790-1872812 AACTGCCCAAAACATATTTGCGG - Intronic
1039751443 8:40482463-40482485 CACAGCCCAAAGCACTCTTCAGG + Intergenic
1041207621 8:55514053-55514075 CAAAGCCCAAAATATATATCTGG + Intronic
1042378948 8:68090537-68090559 AATAACCAAAAACAAATTTCAGG - Intronic
1042963163 8:74323632-74323654 CAGAGCACAAACCAAGTTTCTGG + Intronic
1044315157 8:90741928-90741950 CACAGCCAAAAACAAAACTATGG - Intronic
1044784993 8:95783956-95783978 CACAGCCCCTATCAGATTTCAGG + Intergenic
1049913040 9:288298-288320 CACAGCTCAACATAAAGTTCTGG - Intronic
1052368270 9:27638140-27638162 CACATCCCCAACCAAGTTTCAGG - Intergenic
1052601225 9:30634922-30634944 CCCAGCCCAAAATAGTTTTCAGG - Intergenic
1055873114 9:80908958-80908980 TAGATTCCAAAACAAATTTCTGG + Intergenic
1056436604 9:86580647-86580669 CAAAGCCCAAAACAAGCTTAGGG - Intergenic
1058202055 9:102055859-102055881 CAGAGTCCATAACAAATGTCTGG - Intergenic
1058804837 9:108580696-108580718 CTCAGCACAAATCATATTTCTGG + Intergenic
1058942825 9:109830011-109830033 CAGAGGCTAAAAGAAATTTCAGG - Intronic
1059926681 9:119216765-119216787 CCCAGCCCAAAAGGAATTTGGGG + Intronic
1060428060 9:123523103-123523125 AACAAACCAAAACAGATTTCAGG + Intronic
1060976373 9:127767558-127767580 CAGAGCCCAGAACCAATGTCAGG + Intronic
1186676084 X:11818945-11818967 CAAAGCCCAAATTTAATTTCTGG - Intergenic
1189008527 X:37020439-37020461 CAGAGAGCAAAACAAAGTTCCGG + Intergenic
1189156945 X:38767648-38767670 CACAGCCCCAAACAAAAGACAGG + Intergenic
1194080223 X:89453525-89453547 CACAGCAAAAAAAAAACTTCAGG + Intergenic
1195372355 X:104189851-104189873 CACAGCCCTAACCAAAATTTTGG - Exonic
1195476409 X:105290772-105290794 CTCAACTCAAAACAAATTTGAGG - Intronic
1197355226 X:125431135-125431157 CACAGCCCAATACTAGTGTCAGG + Intergenic
1197803431 X:130376021-130376043 CACTTCACAAAACAAAATTCTGG + Intergenic
1199775741 X:151009908-151009930 CACACACAAAAACAAATTGCAGG + Intergenic
1200673222 Y:6120194-6120216 CACAGTCAAAAACAATTTACAGG - Intergenic