ID: 979273996

View in Genome Browser
Species Human (GRCh38)
Location 4:118794223-118794245
Sequence GTCTTCTGGAAAATAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979273996_979273998 28 Left 979273996 4:118794223-118794245 CCAGGTTTTATTTTCCAGAAGAC 0: 1
1: 0
2: 1
3: 31
4: 286
Right 979273998 4:118794274-118794296 ACTAAATGATGATAACAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979273996 Original CRISPR GTCTTCTGGAAAATAAAACC TGG (reversed) Intronic
900388453 1:2421671-2421693 GTCTTATTGAAAATAACAACGGG + Intergenic
901076275 1:6556700-6556722 GTCTTCTTTAAAAGAAAAGCAGG - Intronic
901547163 1:9966800-9966822 ATCTTCTAGAAAGTAAAAGCAGG + Intronic
901650732 1:10741583-10741605 TTCTCCCGGATAATAAAACCAGG - Intronic
903174210 1:21570893-21570915 GACAGCTGGAAAAGAAAACCCGG - Intronic
903776689 1:25798482-25798504 GGCTTCTGGAAAATAAACAAAGG - Intergenic
905321045 1:37117603-37117625 GTCTTCTAGATAAGGAAACCAGG + Intergenic
905737231 1:40338081-40338103 GTCTTCTTGTAAATAAAATGAGG - Intergenic
907025421 1:51113113-51113135 GTCTTCTAGAAAATAAAGGCCGG - Intronic
907618064 1:55945217-55945239 TTTTTCTGGAAAACATAACCAGG - Intergenic
908141104 1:61185849-61185871 GTATTATGGAAAATATAAACAGG - Intronic
908959763 1:69682309-69682331 TTCTTCTGGACAATAAAATATGG - Intronic
909632493 1:77781581-77781603 GTCCTCTGGAGAATAAGACAAGG - Intronic
910125497 1:83837557-83837579 GTCTTCTTGCAAATAAGACCTGG - Intergenic
910553420 1:88502294-88502316 GTGTTCTGGAAACTAAAAAAAGG + Intergenic
910986893 1:93013989-93014011 GTGTTCAGGAAAAGAAACCCTGG - Intergenic
910998854 1:93140446-93140468 ATGTTCAGGAAAATAAAAACTGG + Intergenic
912135832 1:106659306-106659328 GTCATCTGGGAAATAAGACCTGG - Intergenic
912983286 1:114399996-114400018 GTCTTTTGGAAAACATAACAGGG + Intronic
913015087 1:114724890-114724912 TTCTTTTGAAAAATAAACCCAGG - Intronic
913422818 1:118691446-118691468 GTTTTCTGGTAGATAAAACTGGG - Intergenic
913570288 1:120113151-120113173 ATCTTCTGGAAAATTAGATCTGG + Intergenic
914291095 1:146274128-146274150 ATCTTCTGGAAAATTAGATCTGG + Intergenic
914552139 1:148724911-148724933 ATCTTCTGGAAAATTAGATCTGG + Intergenic
914870460 1:151469774-151469796 CTCATCAGGAAAATAACACCTGG + Intergenic
915048866 1:153046351-153046373 ATCTTGTAGAAAATAAAACGTGG - Intergenic
918123880 1:181565435-181565457 TTCTTCTGGAAGAGAAAACATGG + Intronic
918375673 1:183906917-183906939 GCCTTCTCTAAAACAAAACCAGG + Intronic
918531822 1:185531382-185531404 TTCTTCTGGAAAATATATACAGG + Intergenic
918656669 1:187035344-187035366 TTCCTCTGGAAATTACAACCAGG - Intergenic
918747609 1:188225266-188225288 ATCTTCAGGTAAAGAAAACCTGG - Intergenic
919809069 1:201397975-201397997 GTGCTCTGGAAAAGAAACCCAGG - Intronic
921434684 1:215104595-215104617 ATCTTGGGGAAAATAAAAGCAGG + Intronic
923133113 1:231094477-231094499 CTATTCTGGAAAATAAGACCTGG + Intergenic
1063360047 10:5446188-5446210 CACTTCTGTAAAATAAAAGCAGG + Intronic
1064075640 10:12266426-12266448 GTCTTCTGGATATTAATTCCCGG + Intergenic
1064267167 10:13834403-13834425 GTCTTCCCTAAAATAAAACCCGG + Intronic
1064437291 10:15322297-15322319 GCATTCTGGAAAAGAAAACCTGG - Intronic
1064444666 10:15382851-15382873 GTCTTCAGGGAAATATACCCTGG - Intergenic
1065839731 10:29692426-29692448 CTCTTCTGGAAAATAAGCACAGG + Intronic
1066031691 10:31433569-31433591 GTCTTATGGAAAATCACTCCTGG - Intronic
1068361969 10:55987272-55987294 GTTTTCTGGATACCAAAACCTGG + Intergenic
1068416126 10:56724908-56724930 GTTTTCTAGAAAATAAGAACAGG - Intergenic
1069329799 10:67278564-67278586 GTCCTCTGCACAATAAAACTTGG - Intronic
1070237552 10:74644828-74644850 GTGTTTTTTAAAATAAAACCAGG - Intronic
1070342344 10:75509562-75509584 GTCATCTGTAAAATAAGGCCTGG - Intronic
1071164380 10:82787493-82787515 GCCTTCTTGAAACTAAGACCTGG - Intronic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1072480056 10:95802309-95802331 TTCCTCTGCAAAATAAAACTTGG - Intronic
1072495940 10:95959522-95959544 GTATCCTTGAAATTAAAACCTGG + Intronic
1073934653 10:108616660-108616682 GTCTTCTGGAATCTAACACAGGG + Intergenic
1074638148 10:115344923-115344945 GTCGTCTGGAAGCTAAGACCTGG + Intronic
1074760871 10:116666568-116666590 GTCTCCAGGAAAACAAAACCTGG + Intronic
1075388688 10:122076464-122076486 GCCTTCTGGAAAAGGAAAGCCGG - Intronic
1075687401 10:124373906-124373928 GTGTCCTGGAAAAGAAAACCTGG - Intergenic
1076838926 10:133035460-133035482 TTCCTCTGGACAATAAAACTTGG + Intergenic
1077971475 11:7196436-7196458 CTCTTCTTAAAAATAAAACTAGG + Intergenic
1080072167 11:28102238-28102260 TTCCTCTGCAAAATAAAACTTGG + Intronic
1081728817 11:45354159-45354181 GTCATCTAAAAAATCAAACCAGG + Intergenic
1083012788 11:59419774-59419796 TTCTTCTGCACAATAAAACTTGG - Intergenic
1083375075 11:62213708-62213730 GTATGCTGGAAAACAAAAGCAGG - Exonic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1085159278 11:74326102-74326124 GTCTTCGGCAAAATAAAAAAGGG - Intergenic
1085882061 11:80479250-80479272 GTCTTGTGAAAAAAAAAATCAGG - Intergenic
1086857547 11:91883471-91883493 GTGTACTGGGAAATATAACCGGG - Intergenic
1087934643 11:104018176-104018198 AGCTTCTGGAAAATAAAGACTGG + Intronic
1088532904 11:110830002-110830024 GACCTCTGGAATATAAACCCTGG - Intergenic
1088640926 11:111872129-111872151 GTTTCCTGGTAAATAAAACAAGG - Intergenic
1088945731 11:114510740-114510762 GTATTTTGGAAAATAAAATTTGG + Intergenic
1090505565 11:127309617-127309639 GTCTTCTGAAAAAAAGAAACAGG + Intergenic
1091366831 11:135029220-135029242 GTTTTCTAGAGAATAAAAGCAGG + Intergenic
1091398350 12:168134-168156 GTCTCCTGGAAAAGAGAAGCGGG + Intronic
1092749075 12:11701710-11701732 GTCTTGTAGAAGAGAAAACCGGG + Intronic
1092964218 12:13626157-13626179 GTCTTCTGGAACAACAAAACTGG + Intronic
1093312579 12:17608693-17608715 ATCATCTTGAAAATAAAATCAGG - Intergenic
1093869426 12:24269983-24270005 GTATTCTGGAAAAGAATACCAGG - Intergenic
1095389503 12:41689088-41689110 GAAATCTGGAAAATAAAATCTGG - Intergenic
1096049325 12:48593365-48593387 TTCCTCTGTAAAATAAAACTTGG + Intergenic
1097463375 12:59891476-59891498 TTCTTCTGCAAAAGAAAACATGG + Intergenic
1097543277 12:60967183-60967205 GTCTTCTTAAAAATAAAAAATGG - Intergenic
1097722969 12:63043844-63043866 GGCTGGTGGAAAATAAGACCAGG - Intergenic
1098394179 12:70001260-70001282 GTTTTCTGTCATATAAAACCGGG - Intergenic
1100077046 12:90797817-90797839 GTCTCCTGGAAAAAAAAAAAAGG - Intergenic
1100261519 12:92936517-92936539 TTCTTCTGCACAATAAAACTTGG + Intergenic
1100961476 12:99967611-99967633 CTATTCTGAAAAATAGAACCTGG + Intronic
1101127985 12:101658957-101658979 GTCTTATAGAAGATACAACCTGG + Intronic
1104144307 12:126018010-126018032 GTCTTCTGGAAAAATGATCCTGG - Intergenic
1108050756 13:46435794-46435816 TTTTTCAGGAAAATAAAACACGG - Intronic
1108554851 13:51582939-51582961 TTCCTCTGCACAATAAAACCTGG - Intergenic
1109249254 13:59999051-59999073 GTCTTGGGCATAATAAAACCTGG + Intronic
1109380997 13:61559148-61559170 TTCTTCTGCACAATAAAACTTGG - Intergenic
1109543329 13:63809418-63809440 TTTTTCAGGAAAATAAAACAGGG - Intergenic
1109938233 13:69323014-69323036 TTCTTGGGGAAAATAAAACGTGG + Intergenic
1111256680 13:85678514-85678536 TTCTTCTGGAAAATAACAGTGGG - Intergenic
1111319301 13:86604180-86604202 GTCTTGTGAAAAAAAACACCGGG + Intergenic
1111555416 13:89875140-89875162 GTGTTCTTGAAAATAAACACTGG + Intergenic
1111573938 13:90125856-90125878 GTCTTTTGTAAAGTAAAGCCAGG + Intergenic
1112564529 13:100541784-100541806 TATTTCTGTAAAATAAAACCAGG + Intronic
1113079402 13:106501891-106501913 TTCTTCTTGAAAATAAATTCTGG - Intronic
1113099377 13:106700801-106700823 GTATTTTGGGAAATAAAAACAGG - Intergenic
1115021755 14:28689581-28689603 GCCTGATGGAAAGTAAAACCTGG - Intergenic
1116215475 14:42011588-42011610 TTCCTCTAGAAAATAAAATCTGG + Intergenic
1117600257 14:57366827-57366849 GTCCTCTGGAAAAGAAGATCTGG - Intergenic
1118444768 14:65841011-65841033 GAATACTGGAAAATAAAACTTGG - Intergenic
1118684358 14:68276604-68276626 CTCTTCTGAAATAGAAAACCTGG - Intronic
1119089545 14:71768377-71768399 ATTTTTTGGAAAATATAACCAGG - Intergenic
1119941537 14:78646408-78646430 GTTTTCTGGTTAATAAAGCCTGG - Intronic
1122975937 14:105170755-105170777 GCCTTCTGGAAACTCAAACCAGG - Intergenic
1124638365 15:31379495-31379517 GTCTTCTGGAAAGAAATACCAGG - Intronic
1130030545 15:80309689-80309711 TTTTTCTGAAAAATAAAACATGG - Intergenic
1130248946 15:82282982-82283004 GTATTGTCGAAAATATAACCTGG - Exonic
1130400092 15:83543629-83543651 GTCTTCTGGCAAAACAAGCCTGG - Intronic
1130988010 15:88857352-88857374 GCCTTCTGGAAAAGAAGACTTGG + Exonic
1133009651 16:2904157-2904179 TTCTTCTTGATGATAAAACCAGG - Intergenic
1133166771 16:3953512-3953534 GTCTTCTGGAAAAGAGAAGATGG + Intronic
1136479081 16:30530503-30530525 GTACACTGGAAATTAAAACCTGG + Intronic
1138339007 16:56276295-56276317 CTCATCTGCAAAATAAATCCGGG - Intronic
1139336219 16:66233378-66233400 GTCTGCTGGAGAATAAAACGTGG + Intergenic
1142170558 16:88619959-88619981 GTCTCCTGGAAAAGTAATCCAGG - Intronic
1142519775 17:496839-496861 GTCTTCTGCAAAATAAATCCAGG + Intergenic
1143264387 17:5625155-5625177 GTCTCCTGGACAATCAAGCCTGG - Intergenic
1143276823 17:5717736-5717758 TTCTTCTGAAAAATAATCCCTGG + Intergenic
1143863828 17:9909725-9909747 GTGTTGTGGAAAAGAAAACCAGG - Intergenic
1143986356 17:10917976-10917998 TTCCTCTGCATAATAAAACCTGG + Intergenic
1146911493 17:36651277-36651299 GGCTGCAGGAAAATAAACCCGGG - Intergenic
1149150366 17:53555058-53555080 GTCTTCTGGTCAATGAAACTAGG + Intergenic
1149962306 17:61124219-61124241 TTCTACAGGACAATAAAACCTGG + Intronic
1150505555 17:65694677-65694699 ATCTTTTAGAATATAAAACCAGG - Intronic
1150535419 17:66034127-66034149 GTATTCTCAAAAATAAAAACAGG + Intronic
1151085893 17:71380284-71380306 GTCTCCTGGAAGCTAACACCGGG - Intergenic
1152187346 17:78866078-78866100 GTCATCAGAAAAATAAAATCTGG - Intronic
1153292024 18:3510927-3510949 GTCTTCTCAAAAGTAAAACAAGG + Intronic
1155275758 18:24185769-24185791 GTCTTTTGAAAAATAAAATTAGG + Intronic
1156272950 18:35553969-35553991 ATCTTCTGGAAAAGAAACACAGG + Intergenic
1156322914 18:36044733-36044755 GTCCTCTGGCAAATAAAAGCAGG + Intronic
1157883762 18:51346548-51346570 GTCATCTGGAAAACAAGACCAGG - Intergenic
1158664046 18:59416405-59416427 TTCCTCTGCACAATAAAACCTGG - Intergenic
1158834748 18:61319193-61319215 GTCTTTTGAAAAATAACATCTGG - Intergenic
1165756940 19:38299019-38299041 GTCTTCTGGGAAAGGAAACTGGG + Intronic
1166605271 19:44136702-44136724 GTTGTATGGAAAATAAAAACTGG - Intergenic
1166918368 19:46211591-46211613 GGCTTCTGGAATGTGAAACCCGG - Intergenic
1167753713 19:51397056-51397078 GTTTTCTGGAAAATCAAAGAAGG + Intergenic
1168143391 19:54404609-54404631 TTCCTCTGCACAATAAAACCTGG - Intergenic
926750978 2:16198239-16198261 GCCTTCTGGAAAACAAATGCTGG - Intergenic
928094727 2:28397136-28397158 GTTTTCTTCTAAATAAAACCTGG + Intronic
928358337 2:30641237-30641259 CTCTCGTGGAAGATAAAACCTGG + Exonic
933934814 2:87194021-87194043 GTATTCTGAAAAATACAATCAGG - Intergenic
936508387 2:113126398-113126420 GTCTTCTTGAAAACAATGCCAGG + Intronic
938509960 2:131930968-131930990 GACTTCTGGAAATTAATACAAGG + Intergenic
939907488 2:147935028-147935050 GTCTTCTGAACTAGAAAACCTGG + Exonic
940193511 2:151067331-151067353 TTCTTCTGTAAAATCAAAACAGG + Intergenic
940209918 2:151245749-151245771 TTCTTCTGCACAATAAAACTTGG - Intergenic
940239575 2:151548588-151548610 ATGTGTTGGAAAATAAAACCAGG + Intronic
940944720 2:159602701-159602723 GTATTCTGGAAAATATTAACTGG - Intronic
941151751 2:161923040-161923062 GTCTTCTGGAAAACATAATTTGG - Intronic
941848666 2:170157827-170157849 CTCTGCTGGAAAATAACCCCTGG + Intergenic
942074347 2:172342939-172342961 GTCTTCTGGAAGAGAAAGTCAGG - Intergenic
942447680 2:176088811-176088833 TTTTTTTGGAAAATAAAAGCTGG - Intergenic
943330985 2:186558811-186558833 TTATTCTGGAAACTAAAAACTGG + Intergenic
943608251 2:190001746-190001768 GTCCTGTGGAAAGTAAAACCTGG - Intronic
943828515 2:192427740-192427762 GTGTTCTGGATAATCAAAGCTGG + Intergenic
944123783 2:196270359-196270381 GTATTCAGGAAAGTAAAACTGGG + Intronic
945134473 2:206612483-206612505 TTCTTCTAGAAATAAAAACCTGG - Intronic
945165858 2:206943597-206943619 GTCTTCAGGAAAAAAAAAACTGG + Intronic
947113113 2:226741383-226741405 GGCTTTTGGAAACTAAAGCCAGG - Intronic
947328278 2:229001255-229001277 GTCTTATGGAAAACTAAAACTGG + Intronic
949051024 2:241897330-241897352 ATGTTCTGGAAAATAAAAAGTGG + Exonic
1169761970 20:9105751-9105773 GTCTTCTGGAAAAATAAAGCAGG + Intronic
1170057113 20:12218298-12218320 GTTTTCTGAAAAATAACTCCTGG - Intergenic
1173428577 20:42965229-42965251 GTCCTCTGGGAAAGAAAGCCCGG + Intronic
1173871181 20:46343228-46343250 GTCTCCTGGGAAACAAAACCTGG + Intergenic
1175175079 20:57106635-57106657 GTTTTCCAGAAAAAAAAACCTGG + Intergenic
1175640432 20:60625015-60625037 GGTTTCTGGAGAAAAAAACCAGG + Intergenic
1177981567 21:27921415-27921437 GACTTCTGGAAATTAATACAAGG - Intergenic
1179156787 21:38857929-38857951 GCTTTCTGGAAAAAAAAACATGG + Intergenic
1180839094 22:18950421-18950443 GGCTTCTGAAAAGGAAAACCTGG + Intergenic
1181287761 22:21766571-21766593 GGCTGCTGGAAAGCAAAACCTGG + Intronic
1181876417 22:25944167-25944189 ACCTGCTGGAAAATAAGACCAGG + Intronic
1183149462 22:36026722-36026744 TTCTAATGGAAAATAAAAGCAGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
949351595 3:3128821-3128843 TGCTTCTGGAGAACAAAACCAGG + Intronic
949397487 3:3630330-3630352 ATCTTGTAGCAAATAAAACCAGG + Intergenic
949611836 3:5710847-5710869 TTCTTCTGCACAATAAAACTTGG - Intergenic
951300923 3:20995216-20995238 TTCTTCTGCACAATAAAACTTGG - Intergenic
952585230 3:34884656-34884678 GTGTTATGGAAAATATAACTGGG - Intergenic
953610077 3:44440198-44440220 GGTTTCTGGCAACTAAAACCTGG + Exonic
954044235 3:47915892-47915914 GTCTTCTCGAGACTACAACCTGG + Intronic
954463915 3:50643600-50643622 CTCTTCGGGAAAAAAAAGCCAGG - Intronic
955098511 3:55823717-55823739 GGGATCTGGAAAATGAAACCAGG - Intronic
955838090 3:63079884-63079906 GTGATCTGGAAAATAAAAACAGG - Intergenic
958903684 3:99918276-99918298 GTTTTCTGGTATATAAAACAAGG - Intronic
959193712 3:103149516-103149538 TTCTTGTGGAAAATAGAACCTGG + Intergenic
959228089 3:103612107-103612129 GTCTTCCAGAAAATACCACCTGG - Intergenic
959723466 3:109517510-109517532 GTCTTCTGGACTAAAAAACTGGG + Intergenic
960274735 3:115715696-115715718 GTCTTCTGTAGTATAAAATCTGG - Intronic
960386667 3:117028829-117028851 TTCTTCTGTAGAATAAAACATGG + Intronic
960871530 3:122254527-122254549 GTCTTCAGGAAAAAAAAGGCAGG - Intronic
962449582 3:135501601-135501623 ATGTTCTGGAGAATAAAACCTGG + Intergenic
962615017 3:137116931-137116953 GGCTTCTGGTCAATGAAACCTGG + Intergenic
963557252 3:146807702-146807724 TTCTTCTGGTAAAGAAAAGCAGG - Intergenic
963717870 3:148824576-148824598 GTCTTATTGAAAATACCACCAGG + Intronic
964072693 3:152653936-152653958 GTCTTCTTGAAAATATAAAAGGG + Intergenic
965149552 3:164952207-164952229 TTTTTCTGTAAAATAAAACATGG + Intergenic
965457189 3:168917162-168917184 GTATTCTGTAAAGTAGAACCAGG + Intergenic
965941428 3:174187324-174187346 CTCTTTTGCAAAATAATACCAGG + Intronic
966004925 3:174998459-174998481 GACTGATGGAAAATAAATCCTGG + Intronic
968265119 3:197356757-197356779 ATCTTCTGGATTAAAAAACCAGG + Intergenic
970950941 4:21754600-21754622 GTCTTCTGGAGCAGAAAGCCTGG + Intronic
971083408 4:23242082-23242104 ATTTCCTGGAAAATAAAACAGGG - Intergenic
971495973 4:27265722-27265744 GTCTCCTTGAAAACAAAAGCAGG + Intergenic
977342175 4:95772681-95772703 TTCTTCTGGAAAAAAAAAAAAGG + Intergenic
978604620 4:110465962-110465984 ATCTTTTGGAAAATAAAATAAGG + Intronic
979273996 4:118794223-118794245 GTCTTCTGGAAAATAAAACCTGG - Intronic
980374157 4:131921125-131921147 TTCATCTGGAAAATAGTACCTGG - Intergenic
980660409 4:135850245-135850267 GTCCAGTGGACAATAAAACCAGG + Intergenic
980861807 4:138508084-138508106 GTATTGTGGAAAAAAAAGCCTGG + Intergenic
982231850 4:153215738-153215760 GCCTTTTGGAAATTAAAAACAGG + Intronic
982447095 4:155504836-155504858 CTCTTCTGGAAAATAAACTAGGG - Intergenic
982547315 4:156750391-156750413 TACTTGTGGAAAATAAAACATGG + Intergenic
982618096 4:157667489-157667511 ATCTTCTGGAATATAAAAAAAGG + Intergenic
982940499 4:161546794-161546816 CTCTTCTAGAAAATAAAATGGGG + Intronic
983278301 4:165646298-165646320 GTCTTATGGAAGATAGAATCAGG - Intergenic
983287795 4:165761199-165761221 GTCTTCAGGATTATAAAACCGGG - Intergenic
983356414 4:166664024-166664046 ATCTTCTAAAAAATAAAAACAGG + Intergenic
986676749 5:10192274-10192296 GTCTTCTGGGTAATAAATTCTGG + Intergenic
986703972 5:10440455-10440477 GTCTTTTGGAAAACAAATCATGG - Intergenic
987422974 5:17742464-17742486 GTTTTCTGCAAAATTAGACCAGG + Intergenic
987664604 5:20921206-20921228 TTGTTCTGGGATATAAAACCTGG - Intergenic
987832396 5:23112070-23112092 GGCTTCTCGAAAATATATCCTGG + Intergenic
987865867 5:23537317-23537339 TTTTTATGGAAAATAAAACATGG + Intergenic
988228452 5:28445100-28445122 ATCTTGTGGAAAATCAAAGCTGG - Intergenic
988758081 5:34280976-34280998 TTGTTCTGGGATATAAAACCTGG + Intergenic
989036066 5:37173282-37173304 GTCAGCTGGAAAATAAACCTTGG + Intronic
989719845 5:44512241-44512263 GTTTGCTGGAAAATCAAACCCGG - Intergenic
994678734 5:102859242-102859264 GTCTTCTGGGCAATAACACATGG - Intronic
994687155 5:102969752-102969774 GTCTTCTGGAAAATCCCACTTGG - Intronic
995173992 5:109152403-109152425 GTCTTTTTGAAAATTAAAACTGG - Intronic
996030552 5:118699767-118699789 GCTTTCTGGAAAATCCAACCTGG + Intergenic
996525756 5:124477723-124477745 TTCTTCTGTGAAATAAAACTCGG + Intergenic
996635460 5:125683973-125683995 ATCTTCTCAAAAATAAAAGCAGG - Intergenic
996708829 5:126523834-126523856 GTTTTCTGAAATATAAAACAAGG - Intergenic
996870139 5:128181582-128181604 GCTTTCTGAAAAATAAAACTGGG - Intronic
1000915136 5:167072317-167072339 CTCTTCTGGCAAGTAAAACTAGG - Intergenic
1001430790 5:171660407-171660429 ATCTTCTGGAAGAGAAAACTGGG + Intergenic
1001843780 5:174903237-174903259 GTGTCATGGAAAATAAAAGCAGG + Intergenic
1003606488 6:7566009-7566031 GTCTTCTGGGATATTAAACAAGG - Intronic
1004639361 6:17499517-17499539 TTCTTCAAGAATATAAAACCTGG - Intronic
1006369329 6:33634266-33634288 AACTTCTGGAGAATAAAACAAGG + Intronic
1008274329 6:49526004-49526026 GTCTTCTCAGAAATGAAACCCGG + Intronic
1009373239 6:62934815-62934837 GTCTCCCAGAAAAGAAAACCTGG - Intergenic
1009687319 6:66979332-66979354 GTTCTCTGGAAAAGAAAACTAGG - Intergenic
1009893274 6:69715135-69715157 CCCTTCTGGAAGATAAATCCAGG + Intronic
1011842005 6:91512973-91512995 TTCTTTTGGAAAATAATACTTGG - Intergenic
1012110356 6:95222964-95222986 GTCTTCAGGAAAATACAGTCTGG - Intergenic
1012554619 6:100496422-100496444 TTCTTCAAGAAAATAAAAACAGG - Intergenic
1012621287 6:101347377-101347399 GTATTCTAGGAAAAAAAACCAGG + Intergenic
1017228499 6:152047137-152047159 TTCTACTAGAAAATAAAACAGGG - Intronic
1017597129 6:156041189-156041211 TTCTTCTGGAAAATAGAAGAGGG + Intergenic
1017774454 6:157669963-157669985 GTCTTCTGGAAACTATACCAGGG - Intronic
1017793364 6:157821141-157821163 TACTTCTAAAAAATAAAACCAGG + Intronic
1018636711 6:165867254-165867276 TTCTTCTGGAAAATTATACTTGG - Intronic
1020528944 7:9304114-9304136 GGCTTCTGGAGAATAAAATAAGG - Intergenic
1021196048 7:17675328-17675350 CTCTTCTGGAAAAGCATACCTGG - Intergenic
1021983525 7:26077735-26077757 GTATTTTTGAAAATAAAATCGGG + Intergenic
1022135256 7:27441482-27441504 GATTTCTGGAAAATACAATCTGG + Intergenic
1022210430 7:28203884-28203906 GTCTTATGGAGAATAGAAGCTGG + Intergenic
1022571034 7:31454528-31454550 GTCTTAGGGAAACTAGAACCAGG + Intergenic
1022659530 7:32353927-32353949 GTCTTCTTGAAAATCAACCCAGG + Intergenic
1024463040 7:49679674-49679696 TTCTTCTCCAAAACAAAACCAGG - Intergenic
1025215065 7:57049628-57049650 TTCTTCTGTAAGTTAAAACCTGG + Intergenic
1025656885 7:63527189-63527211 TTCTTCTGTAAGTTAAAACCTGG - Intergenic
1027291562 7:76717589-76717611 GTCTTCTAGAAAATAGAAGAGGG - Intergenic
1027298647 7:76805752-76805774 GTCTTCTGTAAAATAATTCTGGG - Intergenic
1028246061 7:88478397-88478419 TTCCTCTGTAAAATTAAACCTGG - Intergenic
1028797609 7:94921865-94921887 GTCTTTTGAAAAATAAAGGCTGG + Intronic
1029376251 7:100178400-100178422 GTCCTCTGGAAACGAAAGCCTGG + Intronic
1029873240 7:103718135-103718157 GTATTTTGAAAAATAAAAACTGG - Intronic
1030970326 7:116047494-116047516 GTGGTCTGGAAACTAAAACTGGG + Intronic
1032253223 7:130275675-130275697 GTCACCTGGAAAATACAAACAGG + Intronic
1033195437 7:139323337-139323359 GTCTTTTGTAAAAGAAAACTAGG - Intergenic
1035488454 7:159250863-159250885 GTCTTCTGCAGAATGAAAACAGG - Intergenic
1035591071 8:814099-814121 TTCTTCTGTAAAATAAGAGCAGG + Intergenic
1036545545 8:9766314-9766336 GTTTTCAGCAAAATAAATCCCGG - Exonic
1036939120 8:13034073-13034095 CTCTTCTGGAGAATAAAAGCCGG + Intergenic
1037422698 8:18720796-18720818 GTCTTCAGGAAAATAAAATGAGG + Intronic
1041108122 8:54460342-54460364 ATCTTCTAAAAAATAAAATCTGG + Exonic
1041339540 8:56828617-56828639 CTCTTCTGGAAGATAGAAACAGG + Intergenic
1041613322 8:59876629-59876651 GTCATCTGGGAGCTAAAACCTGG - Intergenic
1041721448 8:60979859-60979881 CTCTTTTGGAAAATAAACTCTGG + Intergenic
1044909940 8:97046266-97046288 GTCTTCTGGAAAAAAAAAAAAGG - Intronic
1045851962 8:106711781-106711803 CTCTTCTGTAAAATAACCCCAGG - Intronic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1046389633 8:113553260-113553282 GCAATCTGGAAAATAATACCAGG + Intergenic
1047060219 8:121216948-121216970 CTCTTCTGTAAAATAAAAGTGGG + Intergenic
1047448305 8:124939123-124939145 CTCTCCTGGAAAGTACAACCAGG + Intergenic
1049871983 8:144986967-144986989 GTCTTCTAGAAGACTAAACCAGG - Intergenic
1050213958 9:3300352-3300374 GTATCATGGAAAACAAAACCAGG - Intronic
1052336868 9:27329376-27329398 GTCTTCTGGAATAGAAAAATTGG + Exonic
1052865228 9:33460731-33460753 CACTCCTGGAAAATAAAGCCTGG + Intergenic
1053585181 9:39450284-39450306 GTCTTCTAGAAAATAAAAGATGG + Intergenic
1054581137 9:66914940-66914962 GTCTTCTAGAAAATAAAAGATGG - Intronic
1055251869 9:74317322-74317344 CTCTTCTGGAAAAGAAATTCAGG - Intergenic
1056574603 9:87845641-87845663 GTCTTATGGAAAGTAAACCTAGG + Intergenic
1056660075 9:88536663-88536685 TCCTTCTGGAAAATGAAAACTGG + Intronic
1056822273 9:89851687-89851709 GTTTTATGGAAATTAAAATCCGG + Intergenic
1057349313 9:94281860-94281882 TTCTTCTGCACAATAAAACTTGG - Intronic
1058571098 9:106345533-106345555 GTCTTCCAGAAAATAAAAGAGGG + Intergenic
1060911358 9:127353828-127353850 GTCATCTGGAAAAGGAAACCTGG - Exonic
1061401150 9:130369187-130369209 TCCTGCTAGAAAATAAAACCAGG + Intronic
1187653465 X:21439872-21439894 CTCTTCCGGAAAATAAAGGCAGG + Intronic
1189754830 X:44260414-44260436 TTCTTCTGGAAAACAAAATTTGG + Intronic
1192777354 X:74259143-74259165 CTGTTTGGGAAAATAAAACCAGG + Intergenic
1192971617 X:76237324-76237346 ATCATCTGGATACTAAAACCTGG + Intergenic
1194285732 X:92007936-92007958 GTCATCTGGAAGCTAAAGCCTGG + Intronic
1195432748 X:104807581-104807603 GGCTTGTGGAAAATAGAACATGG - Intronic
1195691184 X:107626929-107626951 GTGTTGTGGAAAAAAAAATCAGG - Intergenic
1198014893 X:132600473-132600495 GTCTTCTCTAAAACAACACCTGG - Intergenic
1199350260 X:146791997-146792019 GCAATCTAGAAAATAAAACCAGG + Intergenic
1200603292 Y:5232475-5232497 GTCATCTGGAAGCTAAAGCCTGG + Intronic