ID: 979276013

View in Genome Browser
Species Human (GRCh38)
Location 4:118815081-118815103
Sequence CCATCTGTGCAGGACCTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 3, 3: 100, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979276007_979276013 7 Left 979276007 4:118815051-118815073 CCAGCTTCTTCTGGGGCTGTGGC 0: 1
1: 2
2: 8
3: 237
4: 5171
Right 979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG 0: 1
1: 0
2: 3
3: 100
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979276013 Original CRISPR CCATCTGTGCAGGACCTCCA GGG Exonic
902050942 1:13563222-13563244 CCATCTGTGCTGGACCCCGTTGG + Intergenic
903135759 1:21308351-21308373 CCACCTGTGTAGGACCCCCAGGG + Intronic
903853194 1:26320569-26320591 CCAGCTGTGCAGCAGCACCAGGG + Intergenic
905210274 1:36369382-36369404 CCTGCTGTGGAGGTCCTCCAAGG + Intronic
905429313 1:37909993-37910015 CCATCTGTGCAGGACCCCACTGG + Intronic
906080945 1:43087850-43087872 CCATCTGTGCAGGACCCCACTGG + Intergenic
906744498 1:48212358-48212380 CCATCTGTGCAGGACCCCACTGG - Intergenic
907503543 1:54901229-54901251 CCATCTGTGCGGGACCCCACTGG - Intergenic
908851641 1:68382564-68382586 CCCTCTGTTCAGGATCTCAAAGG - Intergenic
909467555 1:75990274-75990296 CCATCTGTGCAGGACTTCAGGGG + Intergenic
909776666 1:79491931-79491953 CCATCTGTGCGGGACCCCACTGG - Intergenic
909788242 1:79642093-79642115 CCATCTGTGCGGGACCCCACTGG - Intergenic
909792956 1:79699713-79699735 CCATCTGTGCGGGACCCCACTGG - Intergenic
910144108 1:84058591-84058613 CCATCTGTGCGGGACCCCACTGG - Intergenic
911794478 1:102058792-102058814 CTCACTGGGCAGGACCTCCAAGG + Intergenic
911966948 1:104382529-104382551 TCATCTGTGCAGGACCCCACTGG + Intergenic
912813590 1:112811781-112811803 CCATCTGTGCGGGACCCCACTGG + Intergenic
913245152 1:116864444-116864466 CCATCTGTGTAGGACCCCACAGG + Intergenic
916328883 1:163593363-163593385 CCATCTGTGCGGGACCCCACTGG + Intergenic
916659336 1:166906919-166906941 CCATCAGTTCAGGGCCTCCATGG + Intergenic
917749679 1:178042319-178042341 CCATCTGTGCGGGACCCCACTGG + Intergenic
918046242 1:180942725-180942747 CCATCTCTGTAAGCCCTCCAAGG + Intronic
919476422 1:198037135-198037157 CCATCTGTGCAGGACCCCACTGG + Intergenic
920427318 1:205888640-205888662 CCATCTGTGCGGGACCCCACTGG - Intergenic
921509282 1:216010348-216010370 CCATCTGTGCCGGACCCCACTGG + Intronic
922154040 1:223027775-223027797 CCATCTGTGCGGGACCCCACTGG - Intergenic
923075233 1:230603571-230603593 CCATCTGTGCGGGACCCCACTGG + Intergenic
923770712 1:236935623-236935645 CCATCTGTGCGGGACCCCACTGG - Intergenic
924180679 1:241436313-241436335 CCATCTGTGCAGGACCCCACTGG + Intergenic
1062916565 10:1244776-1244798 CCACCTGTGCAGAAGCTCCCTGG - Intronic
1062971275 10:1651317-1651339 CCATCTGGGCAAGGTCTCCAAGG + Intronic
1063936312 10:11082157-11082179 CCATCTCTGCTTTACCTCCAGGG + Intronic
1064269098 10:13849184-13849206 CCTTCTGTCCGGGACCTCCCAGG - Intronic
1066103373 10:32137025-32137047 CCATCTGTGCAGGACCCCACTGG - Intergenic
1066437187 10:35405849-35405871 CCATCTGTGCAGGACCCCACTGG - Intronic
1067360431 10:45573554-45573576 CCATCTGTGCGGGACCCCACTGG + Intronic
1071187259 10:83059490-83059512 CCATCTGTGCAGGACCCCACTGG + Intergenic
1071334367 10:84589209-84589231 CCATCTGTGCAGGGCCTCCCAGG - Intergenic
1071550766 10:86564607-86564629 CCATCTGTGCGGGACCCCACTGG - Intergenic
1071961134 10:90809767-90809789 CCATCTGTGCAGGACCCCACTGG + Intronic
1072514870 10:96170368-96170390 CCTTCTGAGCTGGACTTCCAGGG + Intronic
1072638328 10:97192152-97192174 CCAACCCTGCAGGAACTCCAAGG + Intronic
1072884545 10:99261931-99261953 CCATCTTTGCAGGACCCCACTGG + Intergenic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1073469758 10:103715257-103715279 CCATCTGTGCAAGGCCCCCGTGG - Intronic
1073683546 10:105729720-105729742 CCATCTGTGCAGGACCCCACTGG + Intergenic
1073933229 10:108600144-108600166 CCGTCTGTGCAGGACCCCACTGG + Intergenic
1074019052 10:109564707-109564729 CCATCTGTGCAGGACCCCACTGG + Intergenic
1074472998 10:113744308-113744330 CCATCTGTTGAGGACCCTCACGG - Intergenic
1074740803 10:116482995-116483017 CCATCTGTGCGGGACCCCACTGG + Intergenic
1075248723 10:120847190-120847212 CCATCTGTGCGGGACCCCACTGG + Intergenic
1077006633 11:361044-361066 CGATCTCTGCTGTACCTCCAGGG - Intergenic
1077883382 11:6368155-6368177 CTATCTGTGCAGGACCCCACTGG + Intergenic
1078264973 11:9748462-9748484 CCATCTGTGCACCCTCTCCATGG - Intronic
1078470272 11:11580813-11580835 CCAGCTGTGAAGCATCTCCAAGG + Intronic
1079727049 11:23890552-23890574 CCATCTGTGCAGGACCCCACTGG - Intergenic
1079847663 11:25490589-25490611 CCATCTGTGCGGGACCCCACTGG - Intergenic
1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG + Intergenic
1082197737 11:49324803-49324825 CCATCTGTGCAGGACCCCATTGG - Intergenic
1082962255 11:58929637-58929659 CCAGCTCTGTAAGACCTCCAGGG + Intronic
1084232330 11:67762025-67762047 CCATCTGTGCGGGACCCCACTGG + Intergenic
1084355577 11:68636053-68636075 CCATCTGTGCGGGACCCCACTGG + Intergenic
1085570219 11:77552274-77552296 CCATCTGTGCAGGACCCCACTGG + Intronic
1085605313 11:77892403-77892425 ATATCTGTGCAGGAACTCAAAGG + Intronic
1086550240 11:88045533-88045555 CCATCTGTGCAGGACCCCACTGG + Intergenic
1087068816 11:94054556-94054578 TCATCTGTGCAGGAACTGCTGGG + Intronic
1087127841 11:94643958-94643980 CCATCTGTGCAGGACCCCACTGG + Intergenic
1087196941 11:95311864-95311886 CCATCTGTGCGGGACCCCACTGG + Intergenic
1088451170 11:109982777-109982799 CAATCTCTTCAGGATCTCCATGG - Intergenic
1089117259 11:116105691-116105713 CCATCAGTGCAGCTCCTCCCTGG + Intergenic
1089987709 11:122829464-122829486 CCATCTGTGCAGGACCCCACTGG + Intergenic
1090107572 11:123868968-123868990 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090526783 11:127546102-127546124 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090546463 11:127772446-127772468 CCATCTGTGCAGGACCCCACTGG - Intergenic
1090871933 11:130756880-130756902 CCATCTGTGCAGGACCCCACTGG - Intergenic
1091056342 11:132422828-132422850 CCATTTGTGCAGGTTTTCCAGGG + Intronic
1091886546 12:4020872-4020894 CCATCTGTGCGGGACCCCACTGG + Intergenic
1092474509 12:8807278-8807300 CCATCTGTGCAGGACCCCATTGG + Intergenic
1092592731 12:9966437-9966459 CCATCTGTGCAAGACCCCACTGG - Intronic
1092739298 12:11613065-11613087 CCATCTGTGCGGGACCCCACTGG - Intergenic
1092789733 12:12060734-12060756 CCATCTGTGCGGGACCCCACTGG + Intronic
1093024358 12:14232921-14232943 CCATCTGTGCGGGACCCCACTGG + Intergenic
1093358462 12:18197292-18197314 CCATCTGTACAGGACCCCACTGG + Intronic
1094289448 12:28830635-28830657 CCACATGTGCAGGACATCCTTGG + Intergenic
1094851539 12:34384471-34384493 CCATGTGTGTAGGTGCTCCATGG + Intergenic
1095998999 12:48113501-48113523 CCATCTGTGCGGGACCCCACTGG - Intronic
1096470393 12:51871912-51871934 CTATCTATGCAGGGCCCCCAGGG + Intergenic
1096907169 12:54946298-54946320 CCATATGTGCAGGACCCCACTGG - Intergenic
1098919929 12:76293801-76293823 CCATCTGTGCAGGACCCCACTGG + Intergenic
1101252918 12:102952901-102952923 CCCCCTGAGCAGGCCCTCCAAGG + Intronic
1101425094 12:104581686-104581708 CCAGCTGTTCATGACATCCAGGG + Intronic
1102116717 12:110408632-110408654 CCATCTGTGCGGGACCCCACTGG - Intergenic
1102500513 12:113349020-113349042 CCCTCTGTTCCTGACCTCCAGGG + Intronic
1104772032 12:131369495-131369517 CATTCTGTCCAGGCCCTCCAAGG - Intergenic
1105854984 13:24364827-24364849 CCATCTGTGCAGGGTCCCAAGGG + Intergenic
1106458750 13:29949811-29949833 CCATCTCTGCACGCCCTGCATGG + Intergenic
1106943466 13:34800985-34801007 CCATCTGTGCGGGACCCCACTGG + Intergenic
1108272868 13:48779802-48779824 CCATATATACAGGACCACCAAGG - Intergenic
1109343604 13:61090698-61090720 CCATCTGTGCAAGACCCCACTGG + Intergenic
1109352939 13:61207129-61207151 CCATCTGTGCAAGACCCCACTGG + Intergenic
1109499316 13:63215465-63215487 CCATCTGTGCAGGACCCCACTGG + Intergenic
1110765503 13:79276477-79276499 CCATCTGTGCGGGACCCCACTGG + Intergenic
1111631678 13:90851957-90851979 CCATCTGTGCCGGACCCCACTGG - Intergenic
1113165813 13:107440828-107440850 CCATCTCTGAAGGAGCTCCTTGG - Intronic
1113324362 13:109267690-109267712 CCATCTGTGCGGGACCCCACTGG + Intergenic
1113419375 13:110158468-110158490 GCAGCTGGGCAGGAGCTCCAGGG + Intronic
1114221702 14:20702925-20702947 CCATCTGTGCGGGACCCCACTGG + Intergenic
1114752287 14:25218566-25218588 CCATCTTCTCAGGACATCCAAGG + Intergenic
1115240579 14:31248713-31248735 CCATCTGTGCGGGACCCCACTGG - Intergenic
1116702380 14:48258752-48258774 CCATCTGTGCGGGACCCCACTGG - Intergenic
1116703265 14:48265744-48265766 CCATCTGTGCAGGACCCCACTGG - Intergenic
1116868534 14:50050693-50050715 TCCTATGTGCAGGACCTCCTGGG - Intergenic
1117801207 14:59446398-59446420 CCATCTGTGCAGGACCCCAATGG + Intronic
1120877247 14:89386367-89386389 CCATCTGTCAAGGTCGTCCACGG + Intronic
1121193274 14:92048079-92048101 CCATCTGTGCAGGACCCCACTGG - Exonic
1121349404 14:93161530-93161552 GCATCTGTGCAGCACCTGCCAGG + Intergenic
1122122877 14:99563855-99563877 CCCTCTGAGCACGGCCTCCAGGG + Intronic
1122255367 14:100472288-100472310 CCATCTGTGCAGTGCCACCTGGG + Intronic
1122507659 14:102241970-102241992 CCATCTGTGCAGGACCCCACTGG + Intronic
1124220716 15:27847628-27847650 ACATCTGTGCAGAACCTGCCAGG - Intronic
1125045801 15:35241112-35241134 CCATCTGTGCGGGACCCCACTGG + Intronic
1125629246 15:41133850-41133872 CCATCTGTGCAGGACCCCACTGG + Intergenic
1126912380 15:53430202-53430224 CCATCTGTGCGGGACCACACTGG - Intergenic
1129259459 15:74356271-74356293 CCATCTGTGCAGGACCCCACTGG + Intronic
1132322989 15:100940710-100940732 CCAGCTTTCCAGCACCTCCAGGG - Intronic
1132340438 15:101074879-101074901 CCATCTGTGCGGGACCCCACTGG + Intronic
1132652284 16:1026950-1026972 CCATCTGTGCTCGGCCTCCCTGG - Intergenic
1132746051 16:1436755-1436777 CCACCTGGCCAGGTCCTCCAGGG + Exonic
1133651416 16:7817046-7817068 CCATCTGTGCGGGACCCCACTGG + Intergenic
1133766739 16:8843449-8843471 CCATCTGTGCGGGACCCCACTGG - Intronic
1134570337 16:15285126-15285148 ACCTCTGTGCAGGACCACCGAGG - Intergenic
1134732039 16:16470927-16470949 ACCTCTGTGCAGGACCACCGAGG + Intergenic
1134935402 16:18241036-18241058 ACCTCTGTGCAGGACCACCGAGG - Intergenic
1136225345 16:28856722-28856744 CCAACTTGGCAGGACCTCCTGGG + Intronic
1137974383 16:53018902-53018924 GCATCTGTGCAGCTCTTCCAGGG - Intergenic
1138759075 16:59520998-59521020 CCATCTGTGCGGGACCCCACCGG - Intergenic
1139246436 16:65449001-65449023 CCATCTGTACAGCAGCTCCAAGG - Intergenic
1139510426 16:67425093-67425115 CCAGCGGTGAGGGACCTCCACGG + Intergenic
1140270800 16:73464907-73464929 CCATGTGTCCAGGCCTTCCAAGG - Intergenic
1141865180 16:86745391-86745413 CCATCTGTGCGGGACCCCACTGG - Intergenic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1143524796 17:7465958-7465980 CCACCCCTGCAGGACCACCAGGG + Exonic
1143715833 17:8768387-8768409 CCATTTCTGCAGCATCTCCAGGG - Intergenic
1144811886 17:18005826-18005848 ACATCTGTGCATCACCTCCAGGG - Intronic
1146946321 17:36876159-36876181 GCATCTGAGGAGGATCTCCAGGG - Intergenic
1147402478 17:40189267-40189289 GCATCTGTGCAGGACATTCTGGG + Exonic
1147939876 17:44038910-44038932 CCATCTGTGCACCAGATCCAGGG + Intronic
1149319592 17:55470142-55470164 CCATCTGTGCAGGTCCCCACTGG + Intergenic
1149476660 17:56966670-56966692 CCATTTGTCCAGTACCGCCAAGG + Intergenic
1150298564 17:64029103-64029125 CCAGCTGTGCAGGCTCTCCAAGG + Intergenic
1150726826 17:67658086-67658108 CCCACTGTGCAGGACCTGAAGGG + Intronic
1151280102 17:73067298-73067320 CCTGCTGTGCAGGACTTTCAGGG + Intronic
1151839729 17:76609321-76609343 CCATCTGTGCGGGACCCCACTGG - Intergenic
1152089497 17:78238947-78238969 CCATGTCTGCAGGACCACCTGGG + Intronic
1154171629 18:12056877-12056899 CCATCTCCGCAGGAACTCCCTGG - Intergenic
1154376244 18:13812323-13812345 CCAAGTGTGCACGAACTCCAGGG - Intergenic
1155173843 18:23286383-23286405 CCATCTGTGCAGGACCCCACTGG + Intronic
1155696992 18:28696467-28696489 CCATCTGTGCGGGACCCCACTGG - Intergenic
1155962022 18:32002950-32002972 CCATCTGTGCGGGACCCCACTGG + Intergenic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1157561029 18:48646280-48646302 CCATCTGTACATCACCTTCAGGG - Intronic
1158020044 18:52831151-52831173 CCAACAGTGCAAAACCTCCAAGG + Intronic
1158394620 18:57069993-57070015 CCATCTGTGCAGGACCCCACTGG - Intergenic
1159164490 18:64683984-64684006 CCATCTGTGCGGGACCCCACTGG + Intergenic
1159929238 18:74294775-74294797 CCATCTGTGCAGGACCCCACTGG + Intergenic
1160060951 18:75528259-75528281 CCATCAGTGGAGGGCTTCCAGGG - Intergenic
1161348014 19:3777640-3777662 CCAGCTGGGCAGATCCTCCATGG + Intergenic
1161712065 19:5854453-5854475 CCATCTGTGCAGGACCCCACTGG + Intergenic
1161793516 19:6374191-6374213 CTCTCTGTGCAGGCCATCCACGG + Exonic
1162320660 19:9969366-9969388 CCATCTGTCCAGGGGCTCCCAGG + Exonic
1163241095 19:16064369-16064391 CCCTCTGGGCATGAGCTCCAGGG - Intergenic
1163944428 19:20522447-20522469 CCATCTGTGCGGGACCCCACTGG - Intergenic
1164004065 19:21133142-21133164 CCATCTGAGCAGGACCCCACTGG - Intergenic
1164258788 19:23551607-23551629 CCATCTGTGCAGGACCCCACTGG + Intronic
1165258265 19:34592916-34592938 CCCTCAATGCAGAACCTCCAGGG - Intergenic
1165496983 19:36158784-36158806 CCATCTGTGCAGGACCCCACTGG - Intergenic
1165510296 19:36262850-36262872 CCATCTGTGCAGGAACCCACTGG - Intergenic
1165835383 19:38751954-38751976 CCATCTGTGCAGGACCCCACTGG + Intronic
1166168972 19:41013607-41013629 TCATCTGGGCAGGACCTTGAAGG + Intronic
1166746298 19:45143420-45143442 CCCTCTGCTTAGGACCTCCATGG - Intronic
1168227962 19:55010150-55010172 CCATCTGTGCGGGACCCCACTGG - Intergenic
1168248164 19:55124884-55124906 CCATCTGTGCAGGACCCCACTGG + Intergenic
925433832 2:3819270-3819292 CCATCTGTGCAGGACCCCACTGG - Intronic
926407792 2:12572100-12572122 CCATCTGTGCGGGACCCCACTGG + Intergenic
926531700 2:14055325-14055347 CCATCTGGTGAGGACCTCCGGGG + Intergenic
926765150 2:16317740-16317762 CCAACTGTGCAGGACCCTCGAGG + Intergenic
928123668 2:28601942-28601964 CTCTCTATGCAGGACGTCCAAGG - Exonic
928770202 2:34696196-34696218 CCATCTGTGCGGGACCCCACTGG + Intergenic
928857196 2:35815424-35815446 CCATCTGTGCGGGACCCCACTGG + Intergenic
930099059 2:47589034-47589056 CCATCTGTGCAGGACCCCACTGG - Intergenic
931026367 2:58116782-58116804 CCATCTGTGCGGGACCCCATGGG - Intronic
931042638 2:58316040-58316062 CCATCTGTGCGGGACCCCGCTGG + Intergenic
931236962 2:60419955-60419977 CCATCTGTGCGGGACCCCACTGG + Intergenic
931459316 2:62436546-62436568 ACACCTATGCAGGACCTCTAAGG - Intergenic
931850447 2:66246275-66246297 CCATCTGTGCAGGACCCCACTGG + Intergenic
931948281 2:67333941-67333963 CCATCTGTGCAGGACCCCACTGG + Intergenic
932358795 2:71088410-71088432 CCATCTGTGCGGGACCCCACTGG - Intergenic
933079293 2:77967453-77967475 CCATCTGTGCGGGACCCCACTGG + Intergenic
933552368 2:83792276-83792298 CCATCTGTGCGGGACCCCACTGG - Intergenic
934141286 2:89050263-89050285 CCATCTGTGCAGGACCCCACTGG + Intergenic
934227954 2:90150281-90150303 CCATCTGTGCGGGACCCCACTGG - Intergenic
934296771 2:91748868-91748890 CCATCGGTGCGGGGCCTCCCCGG + Intergenic
935901733 2:107799938-107799960 CCAGCTGGGCATGACCACCATGG + Intergenic
940339089 2:152560951-152560973 CCCTCTGTGCAGGTCCTCGATGG - Exonic
940530212 2:154869665-154869687 CCATCTGTGCGGGACCCCACTGG + Intergenic
940643017 2:156366913-156366935 CAATCAGTGCATGACCTCCCTGG - Intergenic
940675779 2:156723435-156723457 CCATCCGTGCAGGACCCCACTGG - Intergenic
941340424 2:164298199-164298221 CCATCTGTGCGGGACCCCACTGG + Intergenic
941512793 2:166434609-166434631 TAATCTAGGCAGGACCTCCATGG + Intronic
941935868 2:170981005-170981027 CCATCTGTGCAGGACCCCACTGG - Intergenic
942299237 2:174546591-174546613 CAATTTGTGCAGGACCTGGAGGG - Intergenic
942367922 2:175248478-175248500 CCACCTCTACAGGATCTCCATGG - Intergenic
942730267 2:179055122-179055144 CCATCTGTGAAGGACCCCACTGG - Intergenic
943061595 2:183046230-183046252 CCATCTGTGCAGGACTCCACTGG + Intergenic
943421561 2:187673844-187673866 CCATCTGTGCGGGACCCCACTGG - Intergenic
944251058 2:197580457-197580479 CCATCTGTGCAGGACCCCACTGG + Intronic
944473932 2:200084998-200085020 GCACCTGTGTAGGACCTCCTTGG - Intergenic
944678252 2:202052523-202052545 CCATTTGTTCAGCACATCCATGG + Intergenic
944876107 2:203965283-203965305 CCATCTGTGCGGGACCCCACTGG - Intergenic
945776932 2:214116557-214116579 CCACTTGTGCAGGACCTGCCGGG + Intronic
946886521 2:224227634-224227656 CCATCTGTGCAGGACCCCATTGG + Intergenic
946893297 2:224299019-224299041 CCATCTGTGCGGGACCCCACTGG + Intergenic
946935484 2:224716130-224716152 CCAGCAGTGCAGGAACACCAAGG - Intergenic
948182403 2:235992717-235992739 CCAGGTGTGCAGGACCTCAGCGG - Intronic
1169207631 20:3749140-3749162 CCTCCTGCCCAGGACCTCCATGG - Intronic
1170595479 20:17802304-17802326 TCAACTGGGCTGGACCTCCAGGG - Intergenic
1170820678 20:19754512-19754534 CCATCTGTGCGGGACCCCACTGG - Intergenic
1172779145 20:37425414-37425436 CCATTTGAGCAGGGCCTCGAAGG - Intergenic
1174396183 20:50248169-50248191 GCATCTGTGGGGTACCTCCAGGG + Intergenic
1177102699 21:16916332-16916354 CCATCTGTGCGGGACCCCACTGG + Intergenic
1178589497 21:33897299-33897321 CTATCTATGCAGGGCCACCAAGG - Exonic
1179817752 21:43918348-43918370 CCATGTGCTCAGGAGCTCCAGGG - Intronic
1180054949 21:45352858-45352880 CCATCTGTGGAGGCGCCCCACGG - Intergenic
1183628775 22:39020813-39020835 CCAGCTGGGCGGGACCACCAGGG + Intronic
1183632253 22:39040572-39040594 CCAGCTGGGCGGGACCACCAGGG + Intergenic
1183635646 22:39060882-39060904 CCACCTGTGCAGGACCCCACTGG - Intronic
1183638075 22:39076973-39076995 CCAGCTGGGCGGGACCACCAGGG + Intronic
1183829321 22:40409540-40409562 CCATCAGTGCAGGCCCTACGAGG - Intronic
1184690383 22:46114693-46114715 CCATCTGTGCCAGTCCTGCACGG + Intergenic
1184850065 22:47114975-47114997 CCATCTGTGAGCCACCTCCAGGG + Intronic
1185087695 22:48749602-48749624 CCCTCTGTGCACGACCTGGAGGG - Intronic
949162071 3:894035-894057 CCATCTGTGCAGGAACCCACTGG - Intergenic
949891963 3:8739967-8739989 CCATCTCTGCCAGTCCTCCAGGG - Intronic
950473929 3:13204036-13204058 CCATCTGTGAACCCCCTCCAGGG + Intergenic
950503940 3:13381894-13381916 CCAGCTCCGCAGGAGCTCCATGG - Intronic
951888956 3:27551495-27551517 CCATCTGTGCAGGACCCCACTGG - Intergenic
952343537 3:32464776-32464798 CCATCTGTGCAGGACCCCACTGG - Intronic
953077110 3:39581166-39581188 CCATCTGTGCGGGACCCCACTGG - Intergenic
953177215 3:40563323-40563345 CCATCTGTGCAGGACCCCACTGG + Intronic
953438247 3:42896841-42896863 CCATAAGTGCAGGAACCCCAAGG + Intronic
956233477 3:67042047-67042069 CCATCTGTGCAGGACCCCACTGG - Intergenic
956548968 3:70438229-70438251 CCATCTGTGCAGGACCCCACTGG - Intergenic
957155093 3:76536018-76536040 CCACCTGTGCAGGACCCCACTGG - Intronic
957451458 3:80387224-80387246 CCATCTGTGCGGGACCCCACTGG + Intergenic
957985712 3:87571700-87571722 CCATCTGTGCGGGACCCCACTGG + Intergenic
958421979 3:93940144-93940166 CCATCTGTGCAGAACCCCACTGG + Intronic
961715536 3:128854778-128854800 CCATCTGTGCAGGATGGCAAAGG - Intergenic
961730610 3:128962049-128962071 CCATCTGTGCGGGACCCCACTGG + Intronic
962022166 3:131512474-131512496 CCATCTGTGCAGGACCCCACTGG - Intergenic
962205589 3:133431472-133431494 CCATCTGTGCGGGACCCCACTGG + Intronic
963604220 3:147400416-147400438 GCATCTGGGAAGGAGCTCCATGG - Intronic
964067919 3:152599786-152599808 CCATCTGTGCAGGACTCCACTGG + Intergenic
964300230 3:155278549-155278571 CCATCTGTGTAGGACCCCACTGG - Intergenic
964444237 3:156741999-156742021 CCAGCTGTGCCAGTCCTCCATGG - Intergenic
964906496 3:161725228-161725250 CCATCTGTGCAAGACCCCACTGG - Intergenic
965336351 3:167433558-167433580 CCATCTGTGCAGGACCCCACTGG + Intergenic
965393765 3:168136494-168136516 CCATCATTGCAGGACATTCAAGG + Intergenic
965624859 3:170675889-170675911 CCATCTGTGCGGGACCCCACTGG - Intronic
965640016 3:170821325-170821347 CCATCTGTGCGGGACCCCACTGG - Intronic
965861947 3:173159275-173159297 CCATCTGTGCAGGACCCCACTGG - Intergenic
966066862 3:175830057-175830079 CCATCTGTGCACGACCCCACTGG + Intergenic
966085453 3:176063678-176063700 CCATCTGTGCGGGACCCCACTGG + Intergenic
966232825 3:177669206-177669228 CCATCTGTGTAGGACCCCACTGG - Intergenic
967005335 3:185377899-185377921 CCATCTGTGCGGGACCCCACTGG - Intronic
967244146 3:187469638-187469660 CCATCTGTGCCGGACCCCACTGG - Intergenic
967496244 3:190146848-190146870 CCATCTGTGCGGGACCCCACTGG + Intergenic
967624629 3:191669855-191669877 CCATCTGTGCGGGACCCCACTGG - Intergenic
967643809 3:191898736-191898758 CCATCTGTGCAGGACCCCACTGG - Intergenic
969654076 4:8486149-8486171 CCATCTGTGCGGGACCCCACTGG - Intronic
970087566 4:12366105-12366127 CCATCTGTGCAGGACCCCACTGG + Intergenic
971180584 4:24325553-24325575 CCATCTGTGCGGGACCCCACTGG + Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
972437859 4:39051640-39051662 CCATCTGGGCAGCACCTCAGAGG + Intronic
973052081 4:45609472-45609494 CCCTCTGTGGAGGACCTCACTGG + Intergenic
974173414 4:58294688-58294710 CCATCTCTGCAGGACCCCACTGG - Intergenic
977198408 4:94087995-94088017 CCATCTGTGCGGGACCCCACTGG - Intergenic
977217135 4:94296586-94296608 CCATCTGTGCGGGACCCCACTGG - Intergenic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
979895139 4:126148507-126148529 CCATCTGTGCAGGACCCCACTGG - Intergenic
980284970 4:130769700-130769722 CCATCTGTGCAGGACCCCACTGG + Intergenic
980575614 4:134681277-134681299 CCATCTGTGCGGGACCCCACTGG - Intergenic
980611756 4:135170661-135170683 CCATCTGTGCAGGACCCCGTTGG - Intergenic
980903959 4:138930211-138930233 CCATCTGTGCAGGACCCCACTGG + Intergenic
982414173 4:155111832-155111854 CCATCTGTGCGGGACCCCACTGG - Intergenic
982497086 4:156106837-156106859 CCATCTGTGCGGGACCCCACTGG - Intergenic
982793408 4:159618100-159618122 ACATGTGTTCAGGACCTCCTGGG - Intergenic
983055510 4:163095428-163095450 CCATCTGTGCGGGACCCCACTGG + Intergenic
983448078 4:167878591-167878613 CCATCTGTGCGGGACCCCACTGG + Intergenic
983659593 4:170118794-170118816 CCATCTGTGCAGGACCCCACTGG + Intergenic
983707695 4:170679832-170679854 CCATCTGTGCAGGACCCCACTGG + Intergenic
984099027 4:175464805-175464827 CCATCTGTGCGGGACCCCAATGG - Intergenic
984393593 4:179168260-179168282 CCATCTGTGCGGGACCCCACTGG - Intergenic
985435742 4:189928193-189928215 CCATCTGTGCAGGACCCCATTGG + Intergenic
986193556 5:5517895-5517917 CCATCTGTGCGGGACCCCGCTGG + Intergenic
986555020 5:9001916-9001938 CCATCTGTGCAGGACCCCACTGG - Intergenic
986905794 5:12492141-12492163 CCATCTGTGCGGGACCCCACTGG + Intergenic
987487523 5:18540649-18540671 CCATCTGTGCGGGACCCCACTGG + Intergenic
988199119 5:28047979-28048001 CCATCTGTGCGGGACCCCACTGG + Intergenic
988711984 5:33788043-33788065 CCATCTGTGCTGGAACTCACTGG - Intronic
989521016 5:42400070-42400092 TCAGCTGTGCAGCACCTCCAGGG + Intergenic
989688881 5:44118105-44118127 CCAGCTGTGCAGGACCCCACTGG - Intergenic
990565104 5:57020351-57020373 CCATCTCTGCAGGACCCCACTGG - Intergenic
991425279 5:66484705-66484727 CCATTTGAGCAGGTCTTCCAGGG + Intergenic
992451981 5:76883754-76883776 CCATCTGTGCGGGACCCCAGTGG - Intronic
992960852 5:81955598-81955620 CCATCTGTGCGGGACCCCACTGG + Intergenic
993100766 5:83537219-83537241 CCATCTGTGCAGTACATAAATGG + Exonic
993836726 5:92826315-92826337 CCATCTGTGCAGGACCCCACTGG + Intergenic
994324897 5:98436906-98436928 CCATCTGTGCAGGACCCCACTGG + Intergenic
994989575 5:106980720-106980742 CCATCTGTGCGGGACCCCACTGG + Intergenic
995116607 5:108487769-108487791 ACATCTGTGCAGGGCTTCAAAGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995769402 5:115652871-115652893 CCAACTGTGCAGGACCCCACTGG + Intergenic
995899345 5:117049735-117049757 CCATCTGTGCGGGACCCCACGGG - Intergenic
996052653 5:118950578-118950600 CCATCTGTGCGGGACCCCACTGG - Intronic
996411512 5:123164076-123164098 CCATCTGTGCAGGGCCCCAGGGG + Intronic
997429994 5:133830931-133830953 CCATCTGTAAAGGGCATCCAGGG + Intergenic
997678840 5:135735045-135735067 CCATCTGTGCGGGACCCCACTGG - Intergenic
998469388 5:142371595-142371617 CAATCTGTTGAGGACCTGCATGG - Intergenic
998996377 5:147872343-147872365 CCATCTGTGTAGGACCCCTCTGG - Intronic
999283539 5:150380441-150380463 CCATCTCTCCAGGACCTCAGGGG - Intronic
1000606954 5:163336364-163336386 CCATCTGTGCAGGACCCCACTGG + Intergenic
1001331430 5:170765404-170765426 CCATCTGTGCGGGACCCCACTGG - Intronic
1001709656 5:173768057-173768079 CCCACTGTGCATGACGTCCAGGG + Intergenic
1003430144 6:6031153-6031175 CCATCTGTGCGGGACCCCACTGG - Intergenic
1004507975 6:16262363-16262385 CCATCTGTGCGGGACCCCACTGG - Intronic
1004575244 6:16888296-16888318 CCATCTGTGCGGGACCCCACTGG + Intergenic
1004768552 6:18757436-18757458 CCATCTGTGCGGGACCCCACTGG - Intergenic
1004837025 6:19541244-19541266 CCATCTGTGCAGGACCCCACTGG + Intergenic
1008894341 6:56535209-56535231 CCAGCTGAGCAGGGACTCCAGGG + Exonic
1010071702 6:71751918-71751940 CCATCTGTGCGGGACCCCACTGG - Intergenic
1010662335 6:78585734-78585756 CCATCTGTGCGGGACCCCACTGG + Intergenic
1010826891 6:80485808-80485830 CCATCTGTGCGGGACCCCACTGG - Intergenic
1010894524 6:81348508-81348530 CCATCTGTGCGGGACCCCACTGG - Intergenic
1011367877 6:86601741-86601763 CCATCTGTGCGGGACCCCACTGG - Intergenic
1014396086 6:120927529-120927551 CCATCTGTGCAGGACCCCACTGG + Intergenic
1014612107 6:123558981-123559003 CCATCTGTGCAGGACCCCACTGG + Intronic
1014743605 6:125173580-125173602 CGAGCTGGGCAGGATCTCCAAGG - Intronic
1014891565 6:126851093-126851115 CCATCTGTGCGGGACCCCACTGG + Intergenic
1015165239 6:130194683-130194705 CCATCTGTGCAGGACCCCACTGG + Intronic
1015269677 6:131325742-131325764 CCATTTGTGCAGGACCCCACTGG + Intergenic
1015278177 6:131405152-131405174 CCATCTGTGCGGGACCCCACTGG + Intergenic
1016199786 6:141394240-141394262 GGCTCTGTGCAGGACCTCCCAGG + Intergenic
1016204558 6:141455169-141455191 CCATCTGTGCAGGACCCCACTGG + Intergenic
1016650270 6:146453786-146453808 CCATCTGTGCGGGACCCCACTGG - Intergenic
1016999332 6:149985015-149985037 GCATCTGTGCAGGAACTGCTGGG + Intergenic
1018077618 6:160230833-160230855 CCATCTGTGCAGGACCCCACTGG + Intronic
1018135739 6:160777264-160777286 CCATCTGTGCGGGACCCCACTGG + Intergenic
1018521448 6:164655522-164655544 CCATCTGTGCAGGAACCCACTGG - Intergenic
1019757422 7:2783188-2783210 CCATCTGTGGGGAATCTCCATGG + Intronic
1020316072 7:6906129-6906151 CCATCTGTGCGGGACCCCACTGG + Intergenic
1020794237 7:12661906-12661928 CCATCTGTGCGGGACCCCACTGG + Intergenic
1021225569 7:18021988-18022010 CCAGCAGTGCAAGACCTCCCTGG + Intergenic
1021660646 7:22915458-22915480 CCATCTGTGCAGGACCCCACTGG + Intergenic
1021810683 7:24398616-24398638 CCATCTGTGCGGGACCCCACTGG + Intergenic
1021977874 7:26027558-26027580 CCATCTGTGCGGGACCCCACTGG - Intergenic
1022372894 7:29787186-29787208 CCATCTGTGCGGGACCCCACTGG + Intergenic
1022447424 7:30481571-30481593 CCATCTGTGCAGGACCCCACTGG + Intergenic
1022550734 7:31236734-31236756 TCAGCTGGGCAGAACCTCCATGG - Intergenic
1022854689 7:34303263-34303285 CCATCTGTGCAGGACCCCAATGG - Intergenic
1023698864 7:42873978-42874000 CCATCTGTGCGGGACCCCACTGG - Intergenic
1024039138 7:45536167-45536189 CCCTCTGTACACCACCTCCAAGG - Intergenic
1024906850 7:54393027-54393049 CCATTTGTCCAGTACCACCAAGG - Intergenic
1025847288 7:65211687-65211709 ATATCTGTGCAGGAACTCAAAGG - Intergenic
1025897533 7:65717578-65717600 ATATCTGTGCAGGAACTCAAAGG - Intergenic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1028589889 7:92483159-92483181 CCATTTGTGCAGGACCCCACTGG - Intergenic
1030163588 7:106531772-106531794 CCATCTGTGCAGGACCCCACTGG - Intergenic
1030445760 7:109645489-109645511 CCATCTGTGCAGGACCCCACTGG - Intergenic
1030751479 7:113236949-113236971 CCATCTGTGCGGGACCCCACTGG - Intergenic
1031198807 7:118650870-118650892 ACCTCTGAGCAGGTCCTCCAGGG + Intergenic
1031685868 7:124731378-124731400 CCATCTGTGCGGGACCCCACTGG + Intergenic
1032757676 7:134906493-134906515 GCATTTGTGCAGGACTTACAAGG - Intronic
1033088580 7:138364889-138364911 CCATCTGTGCGGGACCCCACTGG + Intergenic
1033465014 7:141582156-141582178 CCATCTGTACAGGACCCCACTGG - Intronic
1033625608 7:143107161-143107183 CCATCTGTGCAGGACCCCACTGG + Intergenic
1034411627 7:150945281-150945303 CCTCCTGAGCAGGGCCTCCAAGG + Exonic
1036488113 8:9198440-9198462 CCATTTGTGCAAGACCTTCTGGG + Intergenic
1036639514 8:10573608-10573630 CCATCTATGCAGGACCCCACTGG + Intergenic
1036749388 8:11434425-11434447 CCATCTGAGCCAGGCCTCCAGGG + Intronic
1036756050 8:11471783-11471805 CCATCTGAGCAGGAGATCCCTGG - Intronic
1037692373 8:21192945-21192967 CCAGCTGTGCCTGACCTCTAAGG - Intergenic
1038246778 8:25865402-25865424 ACATCTGTGCAGGAAGTCTATGG + Intronic
1038578925 8:28730085-28730107 GCATCTGAACTGGACCTCCAGGG + Intronic
1039319862 8:36417097-36417119 CCATCTGTCAAAGACCACCAGGG - Intergenic
1039761614 8:40582952-40582974 GCATCAGTGCAGAACGTCCAGGG + Intronic
1043717876 8:83508512-83508534 CCATCTGTGCGGGACCCCATTGG - Intergenic
1044258594 8:90093575-90093597 CCATCTGTGCGGGACCACACTGG - Intronic
1044417105 8:91950307-91950329 CCATCTGTGCGGGACCCCACTGG + Intergenic
1044834629 8:96283723-96283745 CCAGCTGCCCAGGAGCTCCAGGG - Intronic
1046559300 8:115816947-115816969 CCATCTGTGCGGGACCCCACTGG + Intergenic
1048585400 8:135770512-135770534 CCATCTGTGCGGGACCCCACTGG - Intergenic
1048728400 8:137411646-137411668 CCATCTGTGCAAGACCCCACTGG - Intergenic
1048773656 8:137921873-137921895 CCATGTGTACAGGACATGCAGGG - Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049868796 8:144957630-144957652 CCATCTGTGCGGGACCCCACTGG - Intergenic
1049873559 8:145000482-145000504 CCGTCTGCGCAGGACCTCATAGG - Intergenic
1050140499 9:2511773-2511795 CCATGTGTGCAGGACCCCACTGG + Intergenic
1051849264 9:21489072-21489094 CCATCTGTGCGGGACCCCACTGG - Intergenic
1054807466 9:69408123-69408145 CCATCTGTGCAGGACCCCACTGG - Intergenic
1055347694 9:75355151-75355173 CCATCTGTGCGGGACCCCATTGG - Intergenic
1055626744 9:78183147-78183169 CCATCTGTGCGGGACCCCACTGG + Intergenic
1055881768 9:81011347-81011369 CCATCTGTGCAGGACCCCACTGG + Intergenic
1056619085 9:88195480-88195502 GCATCTGTGCAGAATCTGCACGG - Intergenic
1057378012 9:94542167-94542189 CCATCTGTGCAGGACCCCACTGG + Intergenic
1057726085 9:97569150-97569172 CCAGCTTTGAGGGACCTCCAAGG + Intronic
1059574641 9:115475699-115475721 CCATCTGTGCAGGACCCCACTGG + Intergenic
1061263504 9:129492695-129492717 GCATCCCTGCAGGACCTCCACGG + Intergenic
1062444175 9:136586676-136586698 ATATCTGTGCATGACCTCAATGG + Intergenic
1185465282 X:350871-350893 CCATCTGTGCAGGCTCTCACGGG - Intronic
1185858407 X:3556494-3556516 CCATCTGTGCGGGACCCCACTGG - Intergenic
1185960669 X:4543854-4543876 CCATCTGTGCGGGACCCCATTGG - Intergenic
1185991082 X:4893932-4893954 CCATCTGTGCGGGACCCCACTGG + Intergenic
1186784091 X:12942163-12942185 CCATCTGTGCGGGACCCCACTGG + Intergenic
1186916411 X:14227120-14227142 ACATCTGTGCTTGACCACCAGGG - Intergenic
1186940846 X:14505867-14505889 GCATCTGTGCTGGACCTATATGG + Intergenic
1187086500 X:16048057-16048079 CCATCTGTGCGGGACCCCACTGG - Intergenic
1188463354 X:30452464-30452486 CCATCTGTGCAGGACCCCACTGG - Intergenic
1189031790 X:37459138-37459160 CCATCTGTGCGGGACCCCACTGG - Intronic
1191014172 X:55791676-55791698 CCATCTGTGCAGGACCCCACTGG - Intergenic
1191713654 X:64178804-64178826 CCATATGTGCAGGGCCTGCATGG + Intergenic
1191805791 X:65133004-65133026 CCATCTGTACAGGACCCCACTGG - Intergenic
1192454615 X:71266523-71266545 CCATCTGTGCAGGACCCCACTGG + Intergenic
1192731500 X:73806281-73806303 CCATCTATGCAGGACCCCACTGG - Intergenic
1193885950 X:86984146-86984168 CCATCTGTGCGGGACCCCACTGG + Intergenic
1194186227 X:90776687-90776709 CCATCTGTGCGGGACCCCACTGG - Intergenic
1194308521 X:92276428-92276450 CCATCTGTGCAGGACCCCACTGG - Intronic
1194367127 X:93025274-93025296 CCATCTGTGCAGGACCCCACTGG + Intergenic
1195016928 X:100789789-100789811 CCATCTGTGCGGGACCCCACTGG - Intergenic
1195908656 X:109868584-109868606 CCATCTGTGCGGGACCCCACTGG - Intergenic
1196074515 X:111560812-111560834 CCATTTGTCCAGTACCACCAAGG - Intergenic
1196572520 X:117281500-117281522 CCATCTGTGCGGGACCCCACTGG + Intergenic
1196773833 X:119321134-119321156 CCATCTGTGCGGGACCCCACTGG - Intergenic
1200423966 Y:3002719-3002741 CCATCTGTGCAGGATGGCAAAGG + Intergenic
1200424470 Y:3006154-3006176 CCATCTGTGCAGGATGGCAAAGG + Intergenic
1200532817 Y:4358766-4358788 CCATCTGTGCGGGACCCCACTGG - Intergenic
1200675340 Y:6141530-6141552 CCATCTGTGCAGGACCCCACTGG + Intergenic
1201307484 Y:12563297-12563319 CCATCTGTGCAGGACCCCACTGG - Intergenic
1201581410 Y:15514716-15514738 CCATCTGTGCAGGACTCCACTGG + Intergenic
1201724797 Y:17140067-17140089 CCATCTCTGCAGGACCCCACTGG - Intergenic