ID: 979281452

View in Genome Browser
Species Human (GRCh38)
Location 4:118872759-118872781
Sequence CTGGATCATACCCCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979281450_979281452 -2 Left 979281450 4:118872738-118872760 CCAAGAACTCTCTCTTGGGATCT 0: 4
1: 122
2: 844
3: 923
4: 794
Right 979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 355
979281445_979281452 23 Left 979281445 4:118872713-118872735 CCTTGAATTCCTTCCTTCATGAG 0: 2
1: 5
2: 36
3: 217
4: 752
Right 979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 355
979281446_979281452 14 Left 979281446 4:118872722-118872744 CCTTCCTTCATGAGATCCAAGAA 0: 2
1: 9
2: 31
3: 53
4: 233
Right 979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 355
979281447_979281452 10 Left 979281447 4:118872726-118872748 CCTTCATGAGATCCAAGAACTCT 0: 1
1: 1
2: 16
3: 54
4: 211
Right 979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979281452 Original CRISPR CTGGATCATACCCCTTTTTC TGG Intronic
900686262 1:3949925-3949947 CTGGATCAAGACCCCTTTTCTGG + Intergenic
901405282 1:9040979-9041001 CAGTATCATACCCATTTTGCAGG - Intronic
907649479 1:56281034-56281056 CTGGATATTAGCCCTTTGTCGGG + Intergenic
907860719 1:58350346-58350368 CTGGATATTAGCCCTTTGTCAGG + Intronic
911357065 1:96835697-96835719 CTGCATTTTTCCCCTTTTTCTGG + Intergenic
911555783 1:99342795-99342817 CTGGATATTAGCCCTTTGTCAGG - Intergenic
911691566 1:100840515-100840537 CTGGATATTAGCCCTTTGTCAGG + Intergenic
911722297 1:101204621-101204643 ATGAATTATACACCTTTTTCTGG - Intergenic
911974300 1:104472135-104472157 CAGCATTGTACCCCTTTTTCAGG + Intergenic
912086159 1:106007592-106007614 CTGGATAATACCCCATTATGAGG - Intergenic
914981637 1:152419771-152419793 CTAGATCATCTCCCTTTTTGAGG + Intergenic
915653813 1:157341179-157341201 CTGGATATTAGCCCTTTGTCAGG + Intergenic
915851981 1:159333989-159334011 CTGGATGAGAACCCTTTTTCTGG - Intergenic
915968809 1:160337362-160337384 CTAGATAATCCCCCTTTTTATGG + Intronic
915986998 1:160476195-160476217 CTGGATATTAGCCCTTTGTCAGG + Intergenic
916527848 1:165628482-165628504 CTGGTCCACACCCCTTTTTGAGG - Intergenic
917915727 1:179699538-179699560 CTGGATATTAGCCCTTTGTCAGG - Intergenic
918584477 1:186169928-186169950 CTGGATATTAGCCCTTTGTCAGG - Intronic
919532191 1:198736511-198736533 CTAGATCTTACCCCTTTTTATGG + Intronic
919937214 1:202261974-202261996 CTGGATATTAGCCCTTTGTCAGG + Intronic
922656141 1:227385456-227385478 CTGAATAATACCCCATTGTCTGG - Intergenic
923080916 1:230654007-230654029 CTGGATATTAGCCCTTTGTCAGG + Intronic
924793120 1:247271225-247271247 CTGGATATTAACCCTTTGTCAGG + Intergenic
924876141 1:248106466-248106488 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1063974397 10:11403719-11403741 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1064739648 10:18419601-18419623 CTGGACAAGACCCCTTTTCCAGG - Intronic
1065308205 10:24388660-24388682 CTGGATATTAGCCCTTTGTCAGG - Intronic
1068551406 10:58411984-58412006 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1069167963 10:65187395-65187417 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1070515361 10:77200458-77200480 CTGGGAAATACCCCTTCTTCAGG + Intronic
1071403786 10:85307199-85307221 CTGGACCATACTTGTTTTTCTGG - Intergenic
1071413207 10:85417113-85417135 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1072922152 10:99585355-99585377 CTTTATCATTCCCATTTTTCAGG - Intergenic
1075341780 10:121652456-121652478 CTGGATATTAGCCCTTTCTCAGG - Intergenic
1075412206 10:122236678-122236700 GTGGATCATGCCACTTGTTCAGG + Intronic
1076620493 10:131784365-131784387 CTGAATCATGAACCTTTTTCTGG - Intergenic
1077812851 11:5656255-5656277 CTGGATTTTAGCCCTTTGTCAGG - Intergenic
1077951834 11:6967677-6967699 CTGGATATTAGCCCTTTTTCAGG + Intronic
1079732612 11:23953771-23953793 CTTGAGCATTCCCATTTTTCTGG + Intergenic
1086067525 11:82762371-82762393 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1086430246 11:86730339-86730361 CTGGATATTAGCCCTTTCTCAGG + Intergenic
1086466798 11:87062292-87062314 CTGCATCTAGCCCCTTTTTCTGG + Intronic
1087207353 11:95411054-95411076 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1087351666 11:97041050-97041072 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1087579653 11:100035857-100035879 CTGGATATTAGCCCTTTGTCAGG + Intronic
1087580796 11:100049725-100049747 CTGGATATTAGCCCTTTGTCAGG - Intronic
1087845592 11:102968959-102968981 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1087984881 11:104665515-104665537 TTGGATAATAGTCCTTTTTCAGG - Intergenic
1088545548 11:110955230-110955252 CTGGAACATGCCCCTTCTTTTGG - Intergenic
1089881922 11:121782312-121782334 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1090583605 11:128186245-128186267 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1090608117 11:128445559-128445581 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1090754489 11:129777788-129777810 CTGAATGATACCCTTTTGTCTGG - Intergenic
1091298939 11:134493171-134493193 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1091893462 12:4081962-4081984 CAGTATCATCCCCGTTTTTCAGG + Intergenic
1093373998 12:18401409-18401431 CATGATCCTACCCCTTTTTCTGG + Intronic
1093530022 12:20149633-20149655 CTTGATGAGAACCCTTTTTCTGG - Intergenic
1093715103 12:22372627-22372649 CTGAATCATATTCCTTTTTATGG - Intronic
1093839267 12:23876227-23876249 CTGGATATTAGCCCTTTGTCAGG - Intronic
1095201017 12:39384458-39384480 CTGGATTATATCCCTGATTCTGG + Intronic
1097304538 12:58054561-58054583 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1097514639 12:60589546-60589568 CTGGATAATTTCTCTTTTTCAGG + Intergenic
1098473991 12:70878351-70878373 CTGGATATTAGCCCTTTGTCAGG - Intronic
1098515289 12:71368627-71368649 CTGGATTTTAGCCCTTTGTCAGG - Intronic
1099418114 12:82419416-82419438 CTGGACAAGAACCCTTTTTCTGG + Intronic
1099779593 12:87176656-87176678 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1100642715 12:96498022-96498044 CTAGATCAAAACCCCTTTTCTGG + Intronic
1100642731 12:96498159-96498181 CTGGATCAAAACCCCTTTTCTGG + Intronic
1102782714 12:115579275-115579297 CTGGATTATACACCTTATGCGGG + Intergenic
1103780243 12:123393816-123393838 CTGGATAATACTCCCTTTTGTGG + Intronic
1104013018 12:124945485-124945507 CTGGATAATACCCCATTGTATGG - Intergenic
1104239070 12:126969535-126969557 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1105546407 13:21353888-21353910 CTGAATCATACTCCATTGTCTGG + Intergenic
1106116687 13:26823772-26823794 CTGGATCAAATCCTTTCTTCTGG + Intergenic
1108170804 13:47739980-47740002 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1109962921 13:69655976-69655998 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1110265779 13:73535834-73535856 CTAGGTCATACTCATTTTTCAGG + Intergenic
1110530793 13:76595319-76595341 CTGGATATTAACCCTTTGTCAGG - Intergenic
1110535536 13:76646860-76646882 CTGGATAATCTCCCTTTTTAAGG + Intergenic
1111017853 13:82404502-82404524 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1111765479 13:92521878-92521900 CTGGATATTAGCCCTTTGTCAGG - Intronic
1111953447 13:94729989-94730011 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1112188943 13:97156287-97156309 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1112541623 13:100319225-100319247 CTGGATATTAGCCCTTTGTCAGG + Intronic
1112671309 13:101642453-101642475 CTGGATATTAGCCCTTTGTCAGG + Intronic
1113027514 13:105957288-105957310 CTGGATGAGACCTCTTTATCAGG - Intergenic
1114702705 14:24695078-24695100 CTTGTTCCTACCCCTTCTTCAGG - Intergenic
1116372053 14:44148669-44148691 CTGAATAATACCCCATTGTCTGG - Intergenic
1116569523 14:46497883-46497905 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1116792044 14:49349470-49349492 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1117065026 14:52004618-52004640 CTAGAACATACCCAATTTTCTGG - Exonic
1117888115 14:60386887-60386909 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1118939718 14:70321916-70321938 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1119353451 14:73985631-73985653 CTGGATATTAGCCCTTTGTCAGG + Intronic
1119681317 14:76594218-76594240 CTGGATAGTACTCCTTTTGCAGG + Intergenic
1123786554 15:23680592-23680614 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1126425808 15:48525910-48525932 CTGGATCATCCCTCTTTTATGGG + Intronic
1127017404 15:54704057-54704079 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1128916491 15:71567369-71567391 CTTGATCACACCCCTGTATCAGG - Intronic
1129706246 15:77796127-77796149 CGGGATCAGACCCCATTTGCAGG - Intronic
1132096907 15:98993207-98993229 CTGGATATTAGCCCTTTGTCAGG - Intronic
1133539009 16:6730578-6730600 CTGAATCCAATCCCTTTTTCAGG - Intronic
1134344284 16:13375061-13375083 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1134532400 16:14994029-14994051 CTGGATATTAGCCCTTTGTCAGG + Intronic
1135157502 16:20065530-20065552 ATGTATTATACCCATTTTTCAGG - Intronic
1135808038 16:25561385-25561407 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1137894473 16:52196168-52196190 CTGGATACTAGCCCTTTGTCAGG + Intergenic
1140992283 16:80224934-80224956 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1142320165 16:89376993-89377015 CTGGAAAGAACCCCTTTTTCCGG + Intronic
1143876456 17:9994780-9994802 CTGGATATTAGCCCTTTGTCAGG - Intronic
1149721288 17:58847160-58847182 CTGGATATTAGCCCTTTGTCAGG + Intronic
1149780321 17:59392318-59392340 CTGGATCTTATCCATTTTTTTGG - Intronic
1151381829 17:73731130-73731152 CTGGGTTATAGTCCTTTTTCAGG + Intergenic
1153511904 18:5863911-5863933 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1153542810 18:6174064-6174086 CTTGATTTTACCCCTTTTTTAGG - Intronic
1154108993 18:11549948-11549970 TTGGAACACACCCCTTTTGCTGG - Intergenic
1154186308 18:12186869-12186891 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1155414044 18:25578042-25578064 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1158631367 18:59117750-59117772 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1161997041 19:7719638-7719660 CTGGAGCCTATCCCTATTTCTGG - Intergenic
1164352984 19:27375482-27375504 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1164678976 19:30121470-30121492 CTGGGTCTTACCCCTTCTCCAGG - Intergenic
1164749863 19:30645258-30645280 CTGGATATTAGCCCTTTGTCAGG + Intronic
1168246685 19:55116141-55116163 CTGCATCATCACCGTTTTTCTGG - Intronic
925514047 2:4659646-4659668 CTGGAGCAAAGCCCTTTATCAGG + Intergenic
925956637 2:8972619-8972641 CTGGATATTAGCCCTTTGTCAGG - Intronic
926249101 2:11143443-11143465 GGGGATCATACCCCTTGATCTGG + Intronic
926856854 2:17266116-17266138 CTGAATAATATCCCATTTTCTGG + Intergenic
928758501 2:34554538-34554560 CTGGATATTAGCCCTTTGTCAGG + Intergenic
928774969 2:34749687-34749709 CTGGATATTAGCCCTTTGTCAGG - Intergenic
930438900 2:51382087-51382109 CTGGATATTAGCCCTTTGTCAGG + Intergenic
930804846 2:55480075-55480097 CTGGATCTTGGCCCATTTTCTGG - Intergenic
931115535 2:59162800-59162822 CTGGATATTAGCCCTTTGTCAGG + Intergenic
931596468 2:63950555-63950577 CTGGATGAGAACCCTTTTTCTGG - Intronic
931815370 2:65895499-65895521 CTGGATATTAGCCCTTTGTCAGG - Intergenic
932066736 2:68571184-68571206 CTGGATATTAGCCCTTTGTCAGG + Intronic
933100307 2:78247305-78247327 CTGGATATTAGCCCTTTGTCAGG - Intergenic
936642765 2:114333999-114334021 CTGGATATTAGCCCTTTGTCAGG + Intergenic
936860077 2:117006369-117006391 CTGGATATTAGCCCTTTGTCAGG - Intergenic
937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG + Intronic
937855917 2:126671938-126671960 CTGGATCACTCACTTTTTTCAGG - Intronic
938942917 2:136184807-136184829 CTGGATATTAGCCCTTTGTCAGG + Intergenic
939937286 2:148308544-148308566 CTGGATATTAGCCCTTTGTCAGG + Intronic
940522438 2:154768076-154768098 CTGGATATTAGCCCTTTGTCAGG + Intronic
941179262 2:162238087-162238109 CTGGATATTAGCCCTTTGTCAGG + Intronic
941564858 2:167094207-167094229 CTGGATATTAGCCCTTTGTCAGG + Intronic
942216936 2:173730378-173730400 CTGGATATTAGCCCTTTGTCAGG + Intergenic
942813424 2:180023417-180023439 CAGCATCATGCTCCTTTTTCTGG - Intergenic
943967998 2:194363091-194363113 CTGGATATTAGCCCTTTGTCAGG + Intergenic
944108537 2:196105969-196105991 CTGGATCATTGCTCTTTTCCTGG - Intergenic
944258567 2:197651154-197651176 CTGGATATTAACCCTTTATCAGG + Intronic
944455691 2:199891845-199891867 CTGGATATTAGCCCTTTGTCAGG - Intergenic
946553564 2:220829789-220829811 CTGGATATTAGCCCTTTGTCAGG - Intergenic
947023927 2:225715373-225715395 CTGGATATTAGCCCTTTGTCAGG - Intergenic
947056737 2:226112503-226112525 CTGGATATTAGCCCTTTGTCAGG - Intergenic
947174762 2:227354308-227354330 CTGCTTCATATCCCTTTTTGTGG + Intronic
947975153 2:234359096-234359118 CTGGATATTAGACCTTTTTCAGG + Intergenic
948166620 2:235867507-235867529 CGGGATCATACACCTTATGCTGG + Intronic
1170038119 20:12011589-12011611 CTGGAGGAGACCCTTTTTTCAGG - Intergenic
1170660865 20:18338176-18338198 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1170794776 20:19537127-19537149 CTGGATATTAGCCCTTTGTCAGG - Intronic
1172467138 20:35164145-35164167 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1173473281 20:43339739-43339761 CTGGATAACACGCCATTTTCTGG + Intergenic
1173998404 20:47357231-47357253 CTGCCTCAAGCCCCTTTTTCTGG - Intergenic
1176518481 21:7805767-7805789 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1177164756 21:17587626-17587648 CTGGATATTAGCCCTTTGTCAGG + Intronic
1177659003 21:24057760-24057782 CAGAATCATTCCCCTTTATCCGG + Intergenic
1177755963 21:25347981-25348003 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1178176967 21:30113134-30113156 GTGAATCATAACCATTTTTCTGG + Intergenic
1178652509 21:34435780-34435802 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1179037882 21:37775240-37775262 CTGGATATTAGCCCTTTGTCAGG + Intronic
1181326388 22:22051851-22051873 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1182148057 22:28009546-28009568 CTGGATCATTCTCCTGCTTCTGG - Intronic
1184159140 22:42687706-42687728 CTGGATCCTACTCTTATTTCTGG - Intergenic
1184262175 22:43324706-43324728 CAGGCTCAGACCACTTTTTCAGG + Intronic
949600375 3:5591692-5591714 CTGGATATTAGCCCTTTGTCAGG + Intergenic
951875098 3:27415300-27415322 CTGGATGAGAGCCCTTTTTCTGG - Intronic
952187232 3:30983131-30983153 CAAGATCATACCCATTTTTCAGG - Intergenic
953620336 3:44527300-44527322 CTGGTTCACACCCTCTTTTCTGG - Intergenic
953828472 3:46275162-46275184 CTGGATATTAGCCCTTTCTCAGG - Intergenic
955168918 3:56543890-56543912 CTGGATATTAGCCCTTTTTCCGG - Intergenic
955939342 3:64133105-64133127 CTGGATGACACACCTTTATCTGG - Intronic
956397614 3:68842433-68842455 CTGGATATTAGCCCTTTGTCAGG + Intronic
956570748 3:70691639-70691661 CTGGATATTAGCCCTTTGTCAGG + Intergenic
957644414 3:82902310-82902332 CTGGATATTAGCCCTTTGTCAGG + Intergenic
957857138 3:85893597-85893619 CTGGATATTAGCCCTTTGTCAGG - Intronic
958751524 3:98197276-98197298 CTGGAAAATACCCCTGTTCCTGG + Intronic
958848819 3:99297455-99297477 CTGGATATTAGCCCTTTGTCAGG - Intergenic
959075671 3:101746779-101746801 CTGGATATTAGCCCTTTGTCAGG - Intronic
959223921 3:103557429-103557451 CTGGATATTAGCCCTTTGTCAGG + Intergenic
960563125 3:119107477-119107499 CTGGATATTAGCCCTTTGTCAGG + Intronic
961026002 3:123558068-123558090 CTGAATAATACCCCGTTGTCTGG - Intronic
962634361 3:137315123-137315145 CTGGATATTAGCCCTTTGTCGGG + Intergenic
962823792 3:139080550-139080572 CAGTTTCAGACCCCTTTTTCAGG + Intronic
965389705 3:168090277-168090299 CTGGATATTAGCCCTTTATCAGG - Intronic
966134205 3:176680082-176680104 CTGGATATTAGCCCTTTGTCAGG - Intergenic
966662623 3:182431205-182431227 CTGGATATTAGCCCTTTGTCAGG - Intergenic
967620082 3:191622879-191622901 CTGGATATTAGCCCTTTGTCAGG + Intergenic
967758566 3:193198079-193198101 CTGGATATTAGCCCTTTGTCTGG + Intergenic
967825741 3:193876014-193876036 TTTGATCCTGCCCCTTTTTCTGG - Intergenic
970041098 4:11797840-11797862 CTGGATATTATCCCTTTGTCAGG - Intergenic
970063339 4:12061907-12061929 CTGGATATTAGCCCTTTGTCTGG - Intergenic
970283723 4:14485914-14485936 CTGGATATTATCCCTTTGTCAGG - Intergenic
970488016 4:16543864-16543886 CTGGATATTAGCCCTTTGTCAGG - Intronic
970938399 4:21601832-21601854 CTGGTTCTTACTCCTTATTCAGG + Intronic
974044814 4:56889832-56889854 CTGGATATTAGCCCTTTGTCAGG - Intergenic
974263488 4:59555345-59555367 CTGGATATTAGCCCTTTGTCAGG + Intergenic
974299633 4:60046940-60046962 CTGGATATTAGCCCTTTGTCAGG + Intergenic
974470103 4:62308608-62308630 CTGGATCTTACTCATTTTTAGGG - Intergenic
974874951 4:67692541-67692563 CTGGACAAGAACCCTTTTTCTGG + Intronic
975212485 4:71717318-71717340 CTGGATACTAGCCCTTTGTCAGG + Intergenic
976627255 4:87199604-87199626 CTGGATATTAACCCCTTTTCAGG - Intronic
977866237 4:102031328-102031350 CTGGATATTAGCCCTTTGTCAGG + Intronic
978276499 4:106957003-106957025 CTGGATATTAGCCCTTTGTCAGG - Intronic
978544247 4:109853479-109853501 CTGGATATTATCCCTTTGTCAGG + Intronic
979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG + Intronic
980540304 4:134185059-134185081 CTGGATAATAATCCTTTATCAGG + Intergenic
981277325 4:142915913-142915935 CTGGATATTAGCCCTTTGTCAGG - Intergenic
981278665 4:142931713-142931735 CTGGATATTAGCCCTTTGTCAGG - Intergenic
981626620 4:146763845-146763867 CTGTATCTTATTCCTTTTTCAGG + Intronic
982120905 4:152142773-152142795 CTGGATATTAGCCCTTTGTCAGG - Intergenic
982631065 4:157829785-157829807 CTGGATATTAGTCCTTTTTCAGG - Intergenic
982839697 4:160168205-160168227 CTGGATATTAGCCCTTTGTCAGG + Intergenic
983285182 4:165730556-165730578 CTGGATATTAGCCCTTTGTCAGG + Intergenic
983988732 4:174092627-174092649 CTGGATATTAGCCCTTTGTCAGG + Intergenic
984172981 4:176383388-176383410 CTGCATCATTTCCCTTTCTCAGG - Intergenic
986620930 5:9673664-9673686 CTTTTTCATTCCCCTTTTTCTGG - Intronic
987769549 5:22282495-22282517 CTGGATATTAGCCCTTTGTCAGG - Intronic
987859602 5:23467588-23467610 CTGGATGATATTCCTTTTTGGGG - Intergenic
989284473 5:39683406-39683428 CTGGATATTAGCCCTTTGTCAGG + Intergenic
989508391 5:42255126-42255148 CTGGATACTATCCCTTTGTCAGG + Intergenic
989607760 5:43261499-43261521 CTGGATATTAGCCCTTTGTCAGG + Intronic
990099311 5:52161938-52161960 CTGGATATTAGCCCTTTGTCAGG - Intergenic
990627536 5:57631463-57631485 CTGGATATTAGCCCTTTGTCAGG + Intergenic
990745376 5:58953964-58953986 CTGGATAGTAGCCCTTTGTCAGG + Intergenic
991376517 5:65973738-65973760 CTGAATCAAACCCTTTGTTCAGG - Intronic
993255284 5:85583127-85583149 CTGGATATTAGCCCTTTGTCAGG + Intergenic
994307555 5:98224978-98225000 CTGGATATTAGCCCTTTGTCAGG - Intergenic
994378562 5:99042872-99042894 CTGGATATTAGCCCTTTGTCAGG - Intergenic
994959507 5:106580498-106580520 TTGGAACAAACCCTTTTTTCCGG - Intergenic
995720187 5:115122494-115122516 CTGGATATTAACCCTTTGTCAGG - Intergenic
996419959 5:123251822-123251844 CTGGATATTAGCCCTTTGTCAGG + Intergenic
997004014 5:129797585-129797607 CTGGATACTAGCCCTTTGTCAGG + Intergenic
997071653 5:130629450-130629472 CTGGATATTAGCCCTTTGTCAGG + Intergenic
997843951 5:137269047-137269069 CTGGACCTTGCCACTTTTTCAGG + Intronic
998262224 5:140639978-140640000 CAGGATGATTCCCCTGTTTCTGG - Intronic
1000204054 5:159040361-159040383 CTGGATCATAGCCATTTTGGTGG - Intronic
1000922998 5:167160574-167160596 CTGGATCTTACATCTCTTTCAGG + Intergenic
1001409183 5:171498182-171498204 CTGCATCTTACCCCTTTCCCAGG + Intergenic
1001422302 5:171597016-171597038 ATGGATCAAACCCCATTTTGGGG - Intergenic
1002230257 5:177759076-177759098 CTGGATATTAGCCCTTTATCAGG - Intronic
1002825753 6:772445-772467 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003405284 6:5822879-5822901 CTGAATCATACTCCATTGTCTGG - Intergenic
1003506844 6:6746681-6746703 CTTGAAGATACCCCTTTTTGTGG + Intergenic
1003788295 6:9513009-9513031 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1004439371 6:15633820-15633842 GTGAATCATAACCTTTTTTCTGG - Intronic
1005357233 6:24996229-24996251 CTGGATCCTACATATTTTTCAGG + Intronic
1006038177 6:31230488-31230510 CTGGATCAACCTTCTTTTTCTGG - Intergenic
1007041257 6:38724584-38724606 CTGGATTATACCTATTTTCCTGG + Intronic
1008884876 6:56421981-56422003 CTGGATCTTAGTCCTTTGTCAGG - Intergenic
1009264586 6:61537009-61537031 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1009802147 6:68552241-68552263 CTGGATATTAGCCCTTTATCAGG - Intergenic
1010314958 6:74437299-74437321 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1010348866 6:74847582-74847604 CTGGATAATAACCCATTGTCTGG + Intergenic
1010476995 6:76299908-76299930 CTGGATAGTAGCCCTTTGTCAGG + Intergenic
1010529410 6:76948727-76948749 CTGGATCTTACTCATTTTTGTGG - Intergenic
1010604674 6:77873494-77873516 CTGGATATTAGCCCTTTGTCAGG + Intronic
1012095056 6:94947247-94947269 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1012418227 6:99033232-99033254 CTGAATAATACCCCATTGTCTGG - Intergenic
1012782503 6:103580721-103580743 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1014077289 6:117249870-117249892 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1016254991 6:142094040-142094062 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1017063134 6:150505216-150505238 CTGGTTAATAATCCTTTTTCAGG - Intergenic
1018132197 6:160742539-160742561 CTGGATATTAGACCTTTTTCAGG + Intronic
1018676318 6:166225278-166225300 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1025217177 7:57068474-57068496 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1025570238 7:62553135-62553157 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1025654169 7:63501989-63502011 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1026112533 7:67469762-67469784 CTGGAGCAGACCTCTTCTTCTGG + Intergenic
1026397898 7:69976830-69976852 CTGGATTTTAACCTTTTTTCGGG + Intronic
1028131809 7:87184375-87184397 CTGGATGATTTCCTTTTTTCAGG + Exonic
1028152388 7:87388877-87388899 CTGGATATTAGCCCTTTGTCAGG - Intronic
1028339528 7:89701449-89701471 CTGAATCTTACCCTTTTTTATGG - Intergenic
1030002808 7:105083492-105083514 CTGGAGGAGAACCCTTTTTCTGG - Intronic
1030131388 7:106204660-106204682 CTGGACAAGAACCCTTTTTCTGG - Intergenic
1030143018 7:106324620-106324642 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1030432791 7:109472592-109472614 CTGGTGCATACCCCTGTCTCTGG + Intergenic
1030871659 7:114763662-114763684 CTGGATACTAGCCCTTTGTCAGG - Intergenic
1030877167 7:114828281-114828303 CTGAATAATACCCTATTTTCTGG - Intergenic
1030972732 7:116080421-116080443 CTGGATATTAGTCCTTTTTCTGG - Intronic
1031902167 7:127423351-127423373 CTGGATATTAGCCCTTTGTCAGG + Intronic
1033410968 7:141117398-141117420 CTGGATATTAGCCCTTTGTCAGG + Intronic
1033721471 7:144063498-144063520 CTGGATCATATCACTTTCTGAGG - Intergenic
1037713793 8:21378886-21378908 CTGGATATTACTCCTTTGTCTGG + Intergenic
1038758925 8:30368273-30368295 TTGTATGATACCTCTTTTTCTGG - Intergenic
1039423502 8:37465484-37465506 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1040123260 8:43706069-43706091 CTGGATATTAGCCCTTTGTCGGG + Intergenic
1040702958 8:50089507-50089529 CTGGATATTAGCCCTTTGTCAGG - Intronic
1041841668 8:62279262-62279284 CTGGATATTAGCCCTTTTTCAGG + Intronic
1042673581 8:71291272-71291294 CAAGAACATTCCCCTTTTTCAGG + Intronic
1042767180 8:72335784-72335806 TTGAATAATAGCCCTTTTTCTGG + Intergenic
1043200943 8:77368752-77368774 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1043239648 8:77916805-77916827 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1043309135 8:78836502-78836524 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1043686378 8:83091859-83091881 CTGAATCATGCACCATTTTCAGG + Intergenic
1044374466 8:91453095-91453117 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1044871080 8:96620563-96620585 CTGGATCATAGGCAATTTTCTGG + Intergenic
1045387243 8:101683180-101683202 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1045408978 8:101896616-101896638 CTGGATATTAGCCCTTTGTCAGG - Intronic
1045798163 8:106070290-106070312 CTGGATAGTAGCCCTTTGTCAGG - Intergenic
1046610262 8:116415557-116415579 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1047242217 8:123101103-123101125 CTGGAACTTATCCATTTTTCTGG + Intronic
1047724971 8:127676431-127676453 CTTGATATTACCCCTTTTACTGG + Intergenic
1048294208 8:133202701-133202723 CTGGCTCATACACCTTTCACGGG + Intronic
1049333241 8:142066856-142066878 TTGGATCTTAACCCTTTTTAGGG - Intergenic
1050559639 9:6821611-6821633 CTGGATATTAGCCCTTTGTCAGG + Intronic
1050700817 9:8336706-8336728 CTGGATATTAGCCCTTTGTCAGG - Intronic
1050870302 9:10559659-10559681 CTGGATATTAGCCCTTTTTCAGG - Intronic
1050870954 9:10569023-10569045 CTGGATATTAGCCCTTTGTCAGG - Intronic
1050972659 9:11896675-11896697 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1051884427 9:21875481-21875503 CTGGATATTAGCCCTTTGTCAGG + Intronic
1051914686 9:22194146-22194168 CTGGATATTAGACCTTTTTCAGG + Intergenic
1052213029 9:25930174-25930196 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1054997838 9:71412349-71412371 CTGGATATTAGCCCTTTGTCAGG - Intronic
1055494695 9:76842584-76842606 CTGGATATTAGCCCTTTGTCAGG - Intronic
1056008240 9:82297384-82297406 CTGGAACATAGCTCTTATTCTGG + Intergenic
1056228324 9:84518902-84518924 CTGGACAATACTACTTTTTCTGG + Intergenic
1057240643 9:93405509-93405531 CTGGATAGGATCCCTTTTTCTGG - Intergenic
1058010579 9:99972458-99972480 CACCATCATACCCCCTTTTCTGG - Intergenic
1058570438 9:106336460-106336482 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1185695384 X:2190207-2190229 CTGGATATTACACCTTTGTCAGG + Intergenic
1186040617 X:5473916-5473938 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1186577876 X:10786068-10786090 CTGGATATTAGCCCTTTGTCAGG - Intronic
1186755854 X:12670839-12670861 CTGGATATTAGCCCTTTGTCAGG - Intronic
1187769750 X:22682064-22682086 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1188078052 X:25803737-25803759 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1188481252 X:30639074-30639096 CAGGATCAGTCCCATTTTTCTGG + Intergenic
1189875369 X:45431144-45431166 CTGGATATTACCCCTTTGTCAGG + Intergenic
1190592727 X:52021322-52021344 CTGGATATTAACCCTTTGTCAGG + Intergenic
1191001735 X:55666841-55666863 CTGGATAGTACACCTTTGTCAGG + Intergenic
1191121234 X:56907728-56907750 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1191141938 X:57123893-57123915 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1191924245 X:66292134-66292156 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1191940983 X:66481704-66481726 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1192228193 X:69244098-69244120 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1192858778 X:75042990-75043012 CTGGATAATAGACCTTTTTCAGG - Intergenic
1192864155 X:75112875-75112897 CTGGCTCTTACCCCTTCTTTTGG + Exonic
1192947856 X:75985138-75985160 CTGGGTCATACATTTTTTTCTGG - Intergenic
1192982400 X:76359935-76359957 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1192982811 X:76365242-76365264 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1192984728 X:76384930-76384952 CTGGATCTTAGCCCTTTGTCAGG - Intergenic
1193217765 X:78884744-78884766 CTGGATGTTAGCCCTTTGTCAGG - Intergenic
1194228714 X:91295382-91295404 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1194312491 X:92329643-92329665 CTGGATCTCATTCCTTTTTCTGG - Intronic
1194454454 X:94084711-94084733 CTGGATCAAGACCCCTTTTCTGG + Intergenic
1194587685 X:95756218-95756240 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1195338933 X:103885800-103885822 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1195425569 X:104725774-104725796 CTGGATATTAGCCCTTTGTCAGG + Intronic
1195436734 X:104852957-104852979 CCTGCTCATACCCCTTTTTCTGG - Intronic
1196436898 X:115682765-115682787 CTGGAACAAGACCCTTTTTCCGG - Intergenic
1196524513 X:116716676-116716698 CTGGATATTAGCCCTTTGTCAGG - Intergenic
1196869447 X:120099004-120099026 CTGCATGATAGCTCTTTTTCAGG + Intergenic
1197048445 X:122028885-122028907 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1197769749 X:130082502-130082524 CTGGCTCAGGCCCCTTTTCCAGG + Intronic
1198314894 X:135455332-135455354 ATGGATTATAGCCCTTTCTCAGG - Intergenic
1198718991 X:139594827-139594849 CTGGATATTAGCCCTTTGTCAGG - Intronic
1199122318 X:144070134-144070156 CTGGATATTAGCCCTTTGTCAGG + Intergenic
1199529635 X:148831788-148831810 CTGCTTCATTCCCCCTTTTCTGG + Intronic
1200620756 Y:5443776-5443798 CTGGATCTCATTCCTTTTTCTGG - Intronic
1201949243 Y:19545853-19545875 CTGGTTCAAACCCCTATTTCAGG + Intergenic
1202065426 Y:20934607-20934629 CTGGATATTAGCCCTTTGTCAGG - Intergenic