ID: 979282170

View in Genome Browser
Species Human (GRCh38)
Location 4:118880370-118880392
Sequence ATTTTAACACTGATTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 1, 2: 0, 3: 39, 4: 425}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979282161_979282170 25 Left 979282161 4:118880322-118880344 CCAAGTTCATATGTTGAAGACCT 0: 1
1: 28
2: 273
3: 1016
4: 1729
Right 979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG 0: 1
1: 1
2: 0
3: 39
4: 425
979282163_979282170 -3 Left 979282163 4:118880350-118880372 CCAGTACCTCAAAGCTCCAGATT 0: 1
1: 0
2: 1
3: 10
4: 119
Right 979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG 0: 1
1: 1
2: 0
3: 39
4: 425
979282159_979282170 29 Left 979282159 4:118880318-118880340 CCCTCCAAGTTCATATGTTGAAG 0: 2
1: 41
2: 354
3: 1332
4: 2974
Right 979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG 0: 1
1: 1
2: 0
3: 39
4: 425
979282162_979282170 5 Left 979282162 4:118880342-118880364 CCTAATCTCCAGTACCTCAAAGC 0: 1
1: 0
2: 3
3: 53
4: 408
Right 979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG 0: 1
1: 1
2: 0
3: 39
4: 425
979282164_979282170 -9 Left 979282164 4:118880356-118880378 CCTCAAAGCTCCAGATTTTAACA 0: 1
1: 0
2: 2
3: 20
4: 287
Right 979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG 0: 1
1: 1
2: 0
3: 39
4: 425
979282160_979282170 28 Left 979282160 4:118880319-118880341 CCTCCAAGTTCATATGTTGAAGA 0: 1
1: 15
2: 241
3: 1178
4: 3385
Right 979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG 0: 1
1: 1
2: 0
3: 39
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979282170 Original CRISPR ATTTTAACACTGATTTTGGG GGG Intronic
900456674 1:2778301-2778323 ATTTCAACACTGCTCTTGGCTGG + Intronic
900899610 1:5507810-5507832 ATTTTAACATGGATTCTGGCAGG - Intergenic
906684940 1:47757141-47757163 ATTTTATCACTGTTTTTTTGTGG + Intergenic
906896767 1:49782477-49782499 ATTTTAACCTGAATTTTGGGAGG - Intronic
907340172 1:53729499-53729521 GTTTTAACAATGCTTTTTGGGGG - Intronic
908218946 1:61984103-61984125 ATTTTATTAATAATTTTGGGGGG - Intronic
908463798 1:64371595-64371617 TTCTTCACAATGATTTTGGGAGG + Intergenic
908932640 1:69335131-69335153 TTTTTCACACTAATTTTGAGTGG + Intergenic
909000650 1:70213397-70213419 ATTTTAACACAGGTTTTTTGTGG - Intronic
909258779 1:73459759-73459781 ATTTCAACACTGATTTTCTATGG - Intergenic
909386627 1:75065570-75065592 ATTTTAAGACTTGTTTTGTGGGG + Intergenic
909423091 1:75488243-75488265 ATTTTTCCACGGACTTTGGGAGG - Intronic
909437737 1:75663173-75663195 ATTTCAACATGGATTTTGAGGGG - Intergenic
909586346 1:77292872-77292894 ATTTTAACACTTATCGTGGCTGG + Intronic
909706937 1:78596671-78596693 AATTTAACTTTTATTTTGGGAGG + Intergenic
910257915 1:85267343-85267365 ATTTTAAGACTGATTTTAATAGG - Exonic
910976421 1:92911146-92911168 GTTTTAACATTAATTTTGAGAGG - Intronic
911646598 1:100343531-100343553 ATTATAATTCTGATTTTGGGGGG + Intergenic
912978920 1:114353189-114353211 ATTTTATCATTAATTGTGGGAGG - Intergenic
913594906 1:120365966-120365988 GTTTTAAAACTGATTTTCTGTGG + Intergenic
914092362 1:144513020-144513042 GTTTTAAAACTGATTTTCTGTGG - Intergenic
914306170 1:146420851-146420873 GTTTTAAAACTGATTTTCTGTGG + Intergenic
914595882 1:149151958-149151980 GTTTTAAAACTGATTTTCTGTGG - Intergenic
916358059 1:163935546-163935568 GTTGACACACTGATTTTGGGTGG + Intergenic
918253695 1:182728071-182728093 ATTGTTACACTGATATTTGGTGG + Intergenic
918376405 1:183913481-183913503 AGATTAACACTGATATTGGTGGG - Intronic
918452992 1:184678102-184678124 ATGTTAACACTGATTTTCTCTGG - Intergenic
918952211 1:191152779-191152801 ATTTTAAAACTAATTTTGTTAGG - Intergenic
918965016 1:191332718-191332740 ATTTCAACATTTATGTTGGGTGG + Intergenic
921582257 1:216908578-216908600 TTTTTAACCCTGATTTTCAGAGG + Intronic
921787495 1:219248202-219248224 CTTTTAACACTGAATTTGTCAGG - Intergenic
923057342 1:230436947-230436969 ATTTCAACACTGATTTATGTTGG - Intergenic
923440760 1:234017941-234017963 ATTTCACCACTCAATTTGGGGGG + Intronic
924392090 1:243572537-243572559 ATTTTAGCATTAACTTTGGGTGG - Intronic
924619013 1:245643927-245643949 TTTATATCACTGGTTTTGGGCGG + Intronic
924680757 1:246229810-246229832 ATTTCAACACGCATTTTGGAGGG + Intronic
924882555 1:248178036-248178058 AATTTAAAACTGCTTTTGAGAGG + Intergenic
1063482491 10:6388199-6388221 TTTTTAACATTTACTTTGGGAGG + Intergenic
1064568231 10:16665425-16665447 AATTTAACAGTGTATTTGGGTGG - Intronic
1065368430 10:24957006-24957028 ATTTTTCCACGGATTTTGAGGGG - Intergenic
1065442052 10:25762868-25762890 ATTTTTACACTAAATATGGGTGG + Intergenic
1065618755 10:27556885-27556907 ATTTTATAACTTATTTTTGGAGG + Intergenic
1065668353 10:28086998-28087020 ATTTCAACACGCAATTTGGGGGG - Intronic
1065777390 10:29133508-29133530 ATTTTGACACTGCTTTTTGATGG - Intergenic
1066510414 10:36089232-36089254 ATTTTCCCACTGATTCTGGGTGG - Intergenic
1067030390 10:42875648-42875670 GTTGTAACACTGACTCTGGGAGG + Intergenic
1068140257 10:52996665-52996687 CTTTAAACACTGCTTTTGGAAGG - Intergenic
1068315944 10:55342642-55342664 CTTGTCACACTGATTTTGGCAGG + Intronic
1070039003 10:72756272-72756294 TTTTAAAAACTGATTTTGGCCGG - Intronic
1070066748 10:73042404-73042426 ATTTTAACAGGCATTTTAGGAGG - Intronic
1070234952 10:74614287-74614309 ATTATAGCACTGATTTCTGGAGG + Intronic
1070377759 10:75850436-75850458 TTTTTAACACTAAGTTTGAGTGG - Intronic
1070653072 10:78252051-78252073 ATTCTAACATGAATTTTGGGGGG + Intergenic
1071017840 10:81019532-81019554 ATTTTAAAATTGATATTTGGCGG + Intergenic
1071580472 10:86764925-86764947 ATATTAAAACTGATTTTGGCCGG + Intronic
1072943389 10:99787442-99787464 ATTTTACCCCTTTTTTTGGGGGG + Intronic
1074213744 10:111363853-111363875 ATCTTAGCAATGATTTTTGGGGG + Intergenic
1076622037 10:131795752-131795774 ATTTCAACATTCATTTTGGTGGG + Intergenic
1078299947 11:10118693-10118715 ATGTCATCTCTGATTTTGGGGGG - Intronic
1079673448 11:23196875-23196897 ATTTTATCAGTGATTTTAAGAGG + Intergenic
1079892242 11:26070495-26070517 ATGTTCAAACTTATTTTGGGAGG - Intergenic
1080137351 11:28871155-28871177 ATTATAAGGCTGACTTTGGGAGG - Intergenic
1080377497 11:31730458-31730480 ATTTTAACATGAATTTTGGAGGG + Intronic
1080881182 11:36322378-36322400 ATTATAAAATTCATTTTGGGAGG - Intronic
1080993801 11:37576802-37576824 TTTTAAACACTTATTTTGAGTGG - Intergenic
1080994067 11:37579374-37579396 ATTCGCAAACTGATTTTGGGGGG + Intergenic
1082219521 11:49617681-49617703 ATTTTAAAAATGATTTGGGCCGG + Intergenic
1082972965 11:59043010-59043032 ATTTTATCACTCATTTGGAGAGG + Intronic
1082977367 11:59086580-59086602 ATTTTATCACTCATTTGGAGAGG + Intergenic
1083318474 11:61830457-61830479 ATGTGAGCACTGATTTTTGGAGG - Intronic
1084027699 11:66462697-66462719 ATTTTAGCATTGTTTTTGGCTGG - Intronic
1084058296 11:66651942-66651964 ATTTTAACATGAATTTTGGGGGG + Intronic
1084449263 11:69224436-69224458 ACCTAAACACTGATTTAGGGAGG + Intergenic
1085354903 11:75827312-75827334 ATGTTAAAACTAATTCTGGGCGG + Intronic
1086630110 11:89007091-89007113 ATTTTAAAAATGATTTGGGCCGG - Intronic
1086738378 11:90336209-90336231 TCTTTAACTCTCATTTTGGGAGG + Intergenic
1086827771 11:91520205-91520227 ATTTTAACTCCTATTTTGGATGG - Intergenic
1087000307 11:93412352-93412374 ATCTTAAAAATGATTTTGGAAGG - Intronic
1087338475 11:96872269-96872291 ATTTTAGCACTGATTTTAATTGG + Intergenic
1088427769 11:109723588-109723610 ATTTCAACTATGAGTTTGGGAGG + Intergenic
1088701011 11:112411792-112411814 ATTTTTACACTAAATATGGGTGG - Intergenic
1088925916 11:114302741-114302763 ATTTCAACACAGAAATTGGGAGG - Intronic
1089734420 11:120539888-120539910 ATTTTAACATTGCATTTGGTGGG - Intronic
1091484598 12:872442-872464 ATTTTAACTTTTGTTTTGGGGGG + Intronic
1097108886 12:56643115-56643137 ATTTGAAAGCTAATTTTGGGAGG - Intronic
1098345734 12:69501337-69501359 TTTTTAACAGTGATTCTGTGGGG + Intronic
1098688753 12:73459669-73459691 ATTTTAACATGCATTTTGGAGGG + Intergenic
1099012327 12:77306349-77306371 ATTTTAACATTGATTAAGAGTGG + Intergenic
1099148804 12:79082113-79082135 AATTCAACACAGATTTTGGAAGG + Intronic
1099619546 12:84983694-84983716 ATCTTACCACTTTTTTTGGGGGG - Intergenic
1100107380 12:91192445-91192467 ATTTTAACATGAAATTTGGGTGG - Intergenic
1101563248 12:105880348-105880370 ATTTTAACATTCATTTTAGAAGG + Intergenic
1102755028 12:115332710-115332732 ATTTTCTCACTGAGTTTTGGAGG - Intergenic
1103019557 12:117523036-117523058 ATTTTTACCCTGATTTAAGGAGG + Intronic
1104522383 12:129487568-129487590 CTTTCAACACTGACTTTGGAGGG - Intronic
1104827445 12:131723412-131723434 ATTTTAAAGCTTATTTTGGAAGG + Intronic
1105530511 13:21214938-21214960 ACTTCAACAGTGAATTTGGGGGG - Intergenic
1105624518 13:22100096-22100118 ATTTCAACATTGAGTTTTGGAGG - Intergenic
1105698322 13:22912823-22912845 ATTTTATCCCTGGTTTTGTGAGG - Intergenic
1105914689 13:24902347-24902369 GTTTTAAAAGTGATCTTGGGTGG + Intronic
1107425607 13:40289804-40289826 GTTTTAACATGAATTTTGGGGGG - Intergenic
1108185132 13:47880993-47881015 TGATTAACTCTGATTTTGGGGGG + Intergenic
1109128643 13:58551292-58551314 ATTTTAACTCTGATTCTGCAAGG + Intergenic
1109976633 13:69843672-69843694 ATTTTAAAAATGATTTAGGATGG + Intronic
1110006145 13:70272697-70272719 ATTTTAAAATGGATTTTGGAGGG + Intergenic
1110036305 13:70689699-70689721 ATTTTCAAACTCATTTTAGGAGG - Intergenic
1110853132 13:80267766-80267788 TTTTTAAGACTGATTTTGGCCGG - Intergenic
1111802385 13:92996658-92996680 ATTTCAACACACATTTTGGAGGG - Intergenic
1112415289 13:99199478-99199500 ATGTTAACACTGATTATAGAAGG - Intergenic
1112593305 13:100784348-100784370 ATTTGCACACTGCTTTTGTGTGG + Intergenic
1112659359 13:101490061-101490083 ATTTCAACACAGAATTTTGGGGG - Intronic
1112660088 13:101497786-101497808 ATTTTAACTCTGATGTGGAGGGG + Intronic
1112981483 13:105390210-105390232 ATTTTTTCACTAATTTTGGAAGG - Intergenic
1113070881 13:106420044-106420066 ATTTTAATGCTAATTTTGAGTGG - Intergenic
1114488194 14:23077179-23077201 ACTTTAACTCTGACTTTTGGAGG - Intronic
1114770664 14:25426578-25426600 ATTTGAAAATTGATTTTGGGGGG + Intergenic
1115793378 14:36905014-36905036 AATTTAACAATTATTTTGGAAGG - Intronic
1115871361 14:37807206-37807228 ATTTTAATACCCTTTTTGGGAGG + Intronic
1116111775 14:40594388-40594410 ATTTCAACATGAATTTTGGGAGG - Intergenic
1116316495 14:43401938-43401960 TTTTTAACAATGACTTTGGAAGG + Intergenic
1117479302 14:56127387-56127409 GTTTTAACACTGCATTTGGGTGG + Intronic
1117549806 14:56823802-56823824 ATTTTAACATGAATTTTGGAGGG - Intergenic
1117739709 14:58804381-58804403 TTGTTAACACTGATCTGGGGAGG + Intergenic
1117798340 14:59417717-59417739 ACTTTAACACAAATTTTGGAGGG - Intergenic
1117865163 14:60140543-60140565 ATTTTTGCATTGATGTTGGGGGG - Exonic
1118448452 14:65873798-65873820 ATTTTAAAAAAAATTTTGGGGGG - Intergenic
1118931926 14:70250776-70250798 ATTATAACACAGATTGTGGGGGG + Intergenic
1119181250 14:72606678-72606700 ATTTCAACACGGAATTTGGTGGG - Intergenic
1119915935 14:78401622-78401644 ATTTTAACATAAATTTTGGAAGG + Intronic
1122431695 14:101654002-101654024 CTTCTAAGACTGATTGTGGGAGG + Intergenic
1125211766 15:37225117-37225139 ATTTTAATACATATTTTTGGAGG + Intergenic
1125345318 15:38713362-38713384 ATTTTAACACTCCTTCAGGGAGG + Intergenic
1126406112 15:48324343-48324365 ACTTTAACATTAAATTTGGGAGG - Intergenic
1126629528 15:50719875-50719897 ATTTACTGACTGATTTTGGGTGG - Intronic
1126869602 15:52973655-52973677 ATTGTAATACTGACTATGGGCGG - Intergenic
1126939185 15:53747166-53747188 ATTTTCAAATAGATTTTGGGTGG - Intronic
1127686729 15:61353166-61353188 ATTTTAACATGAATTTTGGAGGG - Intergenic
1130450747 15:84049347-84049369 GTTTTAACACAGATATTGGATGG + Intergenic
1131358450 15:91767041-91767063 AATTTAAAAATCATTTTGGGAGG - Intergenic
1134907367 16:17991819-17991841 ATATTTACACTGATGTGGGGTGG + Intergenic
1137014246 16:35358484-35358506 ATTTTAACATAAATTTTGGAGGG - Intergenic
1137048583 16:35689953-35689975 ATTTTTACACTGCTTGTGGTCGG + Intergenic
1137320050 16:47371281-47371303 ATTTTTACAAGGATTTTGTGAGG + Intronic
1138145505 16:54605916-54605938 AGTTTAATTATGATTTTGGGGGG - Intergenic
1138228200 16:55317049-55317071 AGTTTGACACAGACTTTGGGTGG - Intergenic
1138954134 16:61950633-61950655 ATATTTAAACTGGTTTTGGGGGG - Intronic
1143361285 17:6373684-6373706 CTTTTGCCACTGAATTTGGGGGG - Intergenic
1144127555 17:12217371-12217393 ATTTCAACATGAATTTTGGGAGG - Intergenic
1144337750 17:14287048-14287070 ATTTTAACATTAATATTGGCTGG + Intergenic
1145693542 17:26768804-26768826 ATTTTGACACTGTTTTGTGGAGG + Intergenic
1145937200 17:28721421-28721443 GTTTGAAAACTTATTTTGGGGGG + Intronic
1146096468 17:29934786-29934808 ATTCACACCCTGATTTTGGGGGG + Intronic
1146711281 17:35043786-35043808 ATTTTAATTCTGATTTTTGTAGG - Intronic
1146828430 17:36045449-36045471 CTTTTACCACGGATTTTGGAAGG + Intergenic
1148616240 17:49002333-49002355 ATTTTAACAATGATTTGTTGAGG + Intronic
1149676837 17:58472305-58472327 ATTAAAACACTTTTTTTGGGGGG - Intronic
1151367085 17:73624537-73624559 ATTTTAAGATTGATTTTAGGAGG - Intronic
1151406739 17:73892541-73892563 ATTTTAACATGAATTTTGGAGGG - Intergenic
1155494087 18:26425884-26425906 AATATAACACTCATTTTGTGAGG - Intergenic
1155533038 18:26786887-26786909 ATTCTAACACTTAGATTGGGTGG - Intergenic
1158848885 18:61474098-61474120 AGTGTAACACTGACTTTGGCAGG - Intronic
1158857458 18:61557216-61557238 ATTTTAAAACTCATTTGGAGTGG - Intergenic
1159095191 18:63894145-63894167 ACTTTAACACTGATTCAGGAAGG + Intronic
1159262232 18:66029324-66029346 ATATTAACACTGTGTTTAGGAGG - Intergenic
1159815583 18:73070360-73070382 ATTTTAAAAGTGCTTTTTGGTGG - Intergenic
1159824210 18:73186685-73186707 ATGTTAACAGTGCATTTGGGTGG - Intronic
1160413035 18:78687867-78687889 ACTTCAACACGAATTTTGGGGGG - Intergenic
1164188835 19:22896970-22896992 ATTTTAACATTTTTTTTTGGTGG + Intergenic
1164469366 19:28516425-28516447 ATCTTAAAACTGATCTTGGCTGG - Intergenic
1167844150 19:52146788-52146810 TTTTTAAAACTAATTTTGTGGGG - Intergenic
925084279 2:1095235-1095257 ACTTCAACACGGATTTTAGGGGG + Intronic
925151460 2:1618162-1618184 ATTCTGACTCTGGTTTTGGGAGG - Intergenic
925603599 2:5635312-5635334 GTTTTAAAACTGATTTTCCGTGG + Intergenic
926077642 2:9954104-9954126 ATTTTAACACTGTAGTTTGGTGG - Intronic
926620751 2:15045073-15045095 ATTTTGATATTTATTTTGGGAGG - Intergenic
926933869 2:18067505-18067527 ATTTCAACACATAATTTGGGAGG - Intronic
928785337 2:34877938-34877960 ACTTTCAAACTCATTTTGGGTGG + Intergenic
929035475 2:37687492-37687514 ATATTAACACAGAATTTGTGGGG - Intronic
929081437 2:38126412-38126434 AATTTAACACGGGATTTGGGTGG - Intergenic
931099161 2:58976060-58976082 AATTTAACTTTGATTTTAGGTGG + Intergenic
931466873 2:62497078-62497100 ATTTTAAAACAGATATTAGGAGG - Intergenic
931868497 2:66435566-66435588 TTTTTTAAACTGATTTTTGGGGG + Exonic
932484194 2:72071745-72071767 ATTTTGACACGAATTTTGGAGGG + Intergenic
933481631 2:82864816-82864838 AATTCAAAACTGATGTTGGGTGG + Intergenic
934047010 2:88180597-88180619 AGGTTAACAGTGATGTTGGGTGG + Intronic
935235397 2:101134106-101134128 ATTTCAACAATGAATTTGGAGGG + Intronic
935948741 2:108309711-108309733 ATTTTAACACTGACATTGTTTGG - Exonic
938684668 2:133726542-133726564 ATTTAAAAACTGATTTTTGGGGG - Intergenic
938989744 2:136615719-136615741 GTTTTAACATGGATTTTGGAGGG - Intergenic
939590059 2:144053876-144053898 GTTTTAACATTGTTTTTTGGTGG - Intronic
940313256 2:152301580-152301602 ATTTTTACACTGACTTTATGAGG - Intergenic
941566718 2:167118071-167118093 ATTTCAACATTAATTTTTGGTGG - Intronic
941839494 2:170065276-170065298 GTTTTAATACTTTTTTTGGGTGG + Intronic
942390565 2:175487989-175488011 TTTTAAACATTTATTTTGGGAGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942638013 2:178029746-178029768 ATTTTAACACGAGTTTTGAGGGG - Intronic
942761701 2:179406322-179406344 AATTTAGCAATGAATTTGGGTGG + Intergenic
943180679 2:184536723-184536745 TTTTTAACTTTAATTTTGGGGGG + Intergenic
943274879 2:185853590-185853612 ATTTTAACATGAATTTTGAGGGG + Intergenic
944390811 2:199217624-199217646 ATTTCAACACGAAATTTGGGTGG - Intergenic
945440021 2:209867393-209867415 ATTTTAAAAATTATTTTTGGGGG + Intronic
945823620 2:214694738-214694760 ATTTTATCACTGATTTAATGTGG - Intergenic
946592388 2:221264810-221264832 TTTTTAACAATAATTTTGGTGGG + Intergenic
946981736 2:225224791-225224813 ATTATAGCATTGACTTTGGGAGG - Intergenic
947759760 2:232595270-232595292 TTTTTAGCACTTTTTTTGGGCGG - Intergenic
947889940 2:233608456-233608478 ATTTCAACACTTGATTTGGGAGG + Intergenic
947895364 2:233666312-233666334 ATTTCAACACTTGATTTGGGAGG + Intronic
1168840577 20:907447-907469 ATTTCAACCTTGATCTTGGGAGG + Intronic
1169169048 20:3449344-3449366 ATTTTAGCACTCACCTTGGGTGG + Intergenic
1169257955 20:4112958-4112980 ATTTTAACAATGATTTTATCAGG + Intergenic
1169913973 20:10669811-10669833 GATTTAGCACTAATTTTGGGAGG + Intronic
1170612443 20:17925721-17925743 CTTTTAACACTGCTTATCGGTGG + Intergenic
1171048431 20:21833065-21833087 ATTTTAACATGAATTTTGGAGGG + Intergenic
1171464237 20:25316645-25316667 TTTTTAACACTGCCTTTGGATGG - Intronic
1173538313 20:43832426-43832448 ATTTTCAGGCTGGTTTTGGGTGG - Intergenic
1175557262 20:59875175-59875197 ATTTTAAGACTAATTTTGAGGGG - Intronic
1177327757 21:19614230-19614252 ATGTTAACACTGACTTTGTTTGG - Intergenic
1177386506 21:20416330-20416352 GTTTAAGCACTTATTTTGGGGGG - Intergenic
1177875882 21:26631496-26631518 ATTTTAACAATTATTTTTGAAGG + Intergenic
1178082028 21:29076074-29076096 ATTTTAACATGAATTTTGGAGGG - Intergenic
1178803773 21:35821357-35821379 ATTCCAAGTCTGATTTTGGGAGG - Intronic
1179097985 21:38332683-38332705 ATTTTAACATGAATTTTGGAGGG + Intergenic
1179543630 21:42100401-42100423 CTTTTCAAACTGATTTGGGGCGG + Intronic
1180658021 22:17440932-17440954 TTATTAACACTGTTTTTGGGGGG + Intronic
1180966543 22:19791238-19791260 ATATTTACAGTTATTTTGGGGGG - Intronic
1181381725 22:22509634-22509656 ATTTTAGCAATCTTTTTGGGGGG + Intergenic
1185191929 22:49443598-49443620 TTTTAAAAACTGATTTTGGCCGG - Intronic
949319643 3:2794986-2795008 ATTTTAACAGAGAATTTGAGGGG + Intronic
949362681 3:3248047-3248069 GTTTCAACACGGATTTTGGGGGG + Intergenic
949791057 3:7792602-7792624 GTTTTAACATTAATTTTGGAGGG - Intergenic
949951059 3:9229107-9229129 ATAATAACCCTGATTTGGGGAGG - Intronic
950051244 3:9991495-9991517 ATCTTAACTATGATTATGGGTGG + Intronic
950300056 3:11869073-11869095 ATCTTAACTATGATTATGGGTGG + Intergenic
951074466 3:18372935-18372957 AGTTTAACACAGATCTTTGGAGG - Intronic
952575422 3:34768606-34768628 ATTTTTACACTGTTGTTGGTGGG + Intergenic
952608408 3:35178536-35178558 ACTTTGACTCTGATTCTGGGTGG + Intergenic
953834029 3:46327789-46327811 ATTTGCAAATTGATTTTGGGGGG + Intergenic
955401458 3:58594621-58594643 ATTTGCAAATTGATTTTGGGAGG - Intronic
956227411 3:66975125-66975147 ATTTTAACATAAAATTTGGGCGG + Intergenic
956666203 3:71644329-71644351 ATTTTTACATTTTTTTTGGGGGG - Intergenic
956939907 3:74146474-74146496 ATTTTAAGACTTATTATTGGTGG + Intergenic
956949461 3:74264585-74264607 ATTTCAACAAAGAATTTGGGGGG - Intronic
957130146 3:76214289-76214311 GTTTTAACACAAATTTTGGAGGG - Intronic
957191992 3:77021629-77021651 ATTTGAACATTAATTTTGGAAGG - Intronic
957196023 3:77069876-77069898 ATTTTAACAAACATTTTTGGAGG - Intronic
957239158 3:77636135-77636157 ATTTTAACGTTGAATTTTGGGGG + Intronic
957587427 3:82149892-82149914 ATTTTAACATAGGTTTTGAGGGG + Intergenic
957912301 3:86636225-86636247 ATTTTAATACTCATTTTTTGAGG + Intergenic
958991216 3:100847959-100847981 ATTATAGCACAGAGTTTGGGTGG - Intronic
959311456 3:104742471-104742493 ATTTTAACATGAATTTTGGAGGG + Intergenic
959343851 3:105166828-105166850 TGTTTCACACTGATTTTGGGGGG - Intergenic
959391047 3:105774006-105774028 ATTTTAACATGAATTTTGGAAGG - Intronic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
959655684 3:108801587-108801609 AATTCAACATTAATTTTGGGAGG + Intergenic
959927556 3:111940967-111940989 ATTCTAACACCAATTTAGGGTGG + Intronic
960051929 3:113247416-113247438 ATTTTAACAGTGATTTCTAGAGG - Intronic
960411961 3:117338055-117338077 TTTTTATCCCTGAATTTGGGTGG + Intergenic
960552262 3:118989093-118989115 ATTTTAACTAAGATTTTGAGAGG + Intronic
960980806 3:123223777-123223799 ATTTTAAATCTAATATTGGGTGG + Intronic
963462773 3:145638027-145638049 ATTTTAACATGAATTTTGGAGGG - Intergenic
963645325 3:147906403-147906425 ATTTTCACAATGATTGTGCGAGG - Intergenic
964205048 3:154165044-154165066 ATTTTATCTTTGATTTTTGGAGG + Intronic
964410474 3:156392322-156392344 ATTTTAAAAAGTATTTTGGGAGG - Intronic
967455160 3:189676862-189676884 ATTTTTCCACTGATGTTGGGGGG - Intronic
967521059 3:190433746-190433768 AATTCAACACTGGTTTTGGGTGG - Intronic
968395802 4:236352-236374 ATTTTAACATGAATTTTGGAGGG + Intergenic
968399750 4:283019-283041 ATTTTAACATGAATTTTGGAGGG - Intronic
968407830 4:356647-356669 ATTTTAACACGAATTTTGAGGGG + Intronic
969350521 4:6595707-6595729 ATTTTAACATGGGTTTTGGAGGG + Intronic
969361571 4:6667443-6667465 ATTTCAACATGGATTTTGAGGGG - Intergenic
970240647 4:14005193-14005215 AATTTAACAGTGGTGTTGGGAGG + Intergenic
971996506 4:33972403-33972425 ATTTTAACACAAATTTTGGCAGG - Intergenic
972291347 4:37692971-37692993 ATTTTAACATAAATTTTGGCTGG - Intergenic
973533074 4:51852205-51852227 ATTTAAAAACTGATTTTAAGTGG + Intronic
974309014 4:60179591-60179613 ATTTTACCACTGAATATGTGGGG + Intergenic
975419283 4:74143435-74143457 ATTTTCACGCTGAGTTTGGAAGG + Intronic
975832308 4:78382462-78382484 TTTTTAAAAATGATTTTTGGTGG - Intronic
976024065 4:80665700-80665722 ATTTTAACATGTAATTTGGGTGG - Intronic
976096653 4:81515465-81515487 ATTTTAACTTTTTTTTTGGGGGG + Intronic
976119690 4:81766092-81766114 TTTCTCACACTGATTTTAGGGGG + Intronic
976158282 4:82171558-82171580 ATTTTACCACTATTTTTTGGGGG - Intergenic
976608048 4:87001158-87001180 ATTTTAATATTGATTTGGGGTGG + Intronic
977118751 4:93069176-93069198 ATTTCAACATTAGTTTTGGGTGG + Intronic
977233857 4:94483189-94483211 ATTTTGAAACTAATTTTGAGGGG - Intronic
977603733 4:98961312-98961334 GTTTCAACACGGATTTTGGAGGG - Intergenic
977959321 4:103067876-103067898 AGTTTAACACTGATATTGCTTGG - Intronic
979150920 4:117313145-117313167 ATTTTAACACTGTTCATGGGTGG - Intergenic
979200477 4:117971950-117971972 TTCTTAAAACTGATTTTAGGAGG - Intergenic
979236869 4:118410243-118410265 GTTTTAAAACAGATTCTGGGAGG - Intergenic
979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG + Intronic
979756553 4:124347644-124347666 ATTCTCACACAAATTTTGGGAGG - Intergenic
979766152 4:124466502-124466524 ATTTTAACAAAGGTATTGGGTGG - Intergenic
979815590 4:125099539-125099561 ATTTTAAAAATTATTTTGGCTGG + Intergenic
979918289 4:126467732-126467754 GTTTTATCACTGATTTTGGTGGG - Intergenic
980030880 4:127828688-127828710 ATTTGAACACTGATATTAGCAGG - Intronic
980457260 4:133060909-133060931 ATTTCAACACGGGTTTTGGAGGG + Intergenic
981422484 4:144567181-144567203 GTTTTAACTATGAATTTGGGAGG - Intergenic
981990314 4:150911702-150911724 ATTTTCAAACTGATTTTATGAGG - Intronic
982317018 4:154042309-154042331 ATTGTAATTCTTATTTTGGGTGG - Intergenic
982453503 4:155579719-155579741 ATTATCACAATTATTTTGGGGGG + Intergenic
983118721 4:163852817-163852839 ATTTTGACATGAATTTTGGGAGG - Intronic
983561329 4:169104542-169104564 ATTTTAAAACTGGTTTTAGGGGG + Intronic
983728737 4:170966306-170966328 ATTTTAACAAAGCCTTTGGGAGG - Intergenic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
983922925 4:173366449-173366471 AGTTTCACAATGAATTTGGGAGG + Intergenic
984350924 4:178592054-178592076 AATGTAACATTGATTTTGTGAGG + Intergenic
984670538 4:182480761-182480783 ATTTTAACTCTGAATTTATGTGG + Intronic
984774048 4:183465035-183465057 ATTTTTAAATTGATTATGGGTGG - Intergenic
984888909 4:184474214-184474236 ATATTAATACTGATTTTTGGAGG - Intronic
986236241 5:5913563-5913585 AGTTTAACACTTTTTTTGTGGGG + Intergenic
986243185 5:5979904-5979926 ACTTGAACACTGATTTTGGCTGG + Intergenic
987015986 5:13820079-13820101 ATTTTCACAATGATCTTGAGAGG - Intronic
987442491 5:17973345-17973367 ATTTTAAAATTAATTTTAGGAGG + Intergenic
987716765 5:21581418-21581440 ATTTCAACATTAATTTTGGAGGG - Intergenic
988220430 5:28338957-28338979 ATTTTGACAGTGATTTTAAGTGG - Intergenic
988470919 5:31537530-31537552 ATATTAACCATGATTTTAGGTGG + Intronic
988549927 5:32191134-32191156 ATTATAAAACTGTTTTGGGGAGG - Intergenic
988657249 5:33225956-33225978 GTTTTAACATAAATTTTGGGAGG - Intergenic
988862148 5:35293492-35293514 ATTTTCACACTCATTTTATGAGG - Intergenic
989790479 5:45393478-45393500 ATTTTTAAACTGATTTTGAGTGG - Intronic
990644942 5:57833538-57833560 ATTTTAACATTGAGTTAGTGAGG + Intergenic
990691003 5:58364149-58364171 GTTTTATCAATGAGTTTGGGTGG + Intergenic
990981402 5:61605397-61605419 TTTTTAACACAGATTTCTGGTGG - Intergenic
991985454 5:72281315-72281337 ATTTTAACACTCATTTTATGAGG + Intronic
993303244 5:86240960-86240982 ATTTTAATGCTAATTTTGTGAGG + Intergenic
993360642 5:86971047-86971069 ATTTTCACAGTGACTTTAGGAGG + Intergenic
993437442 5:87915268-87915290 ATTTTAACATGAATTTTGGTGGG + Intergenic
993961447 5:94301875-94301897 ATTTGAACACTCATTTTAGAGGG - Intronic
994283569 5:97937206-97937228 ATTTTATGATTAATTTTGGGGGG - Intergenic
994697128 5:103086358-103086380 ACTTCAACACAAATTTTGGGAGG + Exonic
995227142 5:109713219-109713241 ATTTTAGGACTGAGTTTGGGGGG + Intronic
995726343 5:115184651-115184673 ATTTTAACAGTAAATTTGGAGGG + Intergenic
996887925 5:128380942-128380964 ATTTTAAAATTTATTTTAGGAGG - Intronic
996939730 5:128990151-128990173 ATTTTAACAGAGTTTTTGGACGG + Intronic
997189092 5:131913896-131913918 ATTTCAACACGAATTTTGGAGGG - Intronic
1001945463 5:175774260-175774282 ATTTTTACACTAAATATGGGTGG - Intergenic
1003400935 6:5790309-5790331 ACTTCAACAGTGAATTTGGGGGG + Intergenic
1003821590 6:9904292-9904314 TTTTTTACACTAATTTTGGAAGG - Intronic
1004570772 6:16842524-16842546 ATTTTAACAGTGATTCTCGTTGG - Intergenic
1005302673 6:24485963-24485985 ATTTTAAGACTCATTTTGGCTGG - Intronic
1005381126 6:25235420-25235442 ATTTTCACATTGATTATGTGTGG + Intergenic
1005721146 6:28603252-28603274 ATTTAAAAATTTATTTTGGGCGG - Intronic
1005725454 6:28643354-28643376 TATTTAAAACTAATTTTGGGGGG + Intergenic
1006842151 6:37035859-37035881 ATTTTTAAAATTATTTTGGGGGG + Intergenic
1007518247 6:42430355-42430377 GGTCTAATACTGATTTTGGGGGG - Intronic
1008802211 6:55382903-55382925 TTTTTATCACAGATTTTGAGGGG + Intronic
1008813365 6:55532867-55532889 ATGTTAACACTGTTTTTGTTGGG - Intronic
1008983299 6:57512019-57512041 ATTTAAACACTGATATTCTGTGG - Intronic
1009171358 6:60404886-60404908 ATTTAAACACTGATATTCTGTGG - Intergenic
1009633453 6:66231433-66231455 ATTTCAACATTAATTTTGGTCGG + Intergenic
1010053695 6:71538724-71538746 ATTTCAAGAATGATTTAGGGAGG + Intergenic
1010493274 6:76500689-76500711 ATTTTACAAATTATTTTGGGTGG - Intergenic
1010896577 6:81371988-81372010 ATTGACACACTGATGTTGGGAGG + Intergenic
1010904082 6:81464801-81464823 ATTTTAACACGGATTAGTGGAGG - Intergenic
1010930700 6:81799421-81799443 ATTTTAACTCTGATTTTCTTTGG + Intergenic
1011679447 6:89768736-89768758 ATTTTAACTCTTTTTTTGGGGGG - Intronic
1011719421 6:90139904-90139926 ATTTAAGCCCTGATTTGGGGAGG - Intronic
1011768233 6:90647713-90647735 AGTTAAACACTGATTTTAGTGGG + Intergenic
1012912255 6:105131781-105131803 ATTTTAAGACAGAGTTTTGGAGG - Intronic
1013121125 6:107142175-107142197 ATTTTAACACTGGGGTTGGTTGG - Intergenic
1013590068 6:111612453-111612475 TTTTCAACATGGATTTTGGGGGG - Intergenic
1014113636 6:117648218-117648240 ATTTTCGCATTGATTTGGGGTGG - Intergenic
1015286587 6:131492314-131492336 ATTTTAACATATCTTTTGGGGGG - Intergenic
1015436303 6:133193207-133193229 ATTTCAACACAAATTTTGGAGGG - Intergenic
1016466547 6:144331094-144331116 ATTTTCACACTAATTATTGGCGG - Intronic
1016792787 6:148083453-148083475 ATTAAAACATTTATTTTGGGAGG + Intergenic
1017946878 6:159103397-159103419 ATTTTAACAATCATTTTTAGCGG - Intergenic
1018016676 6:159719068-159719090 ATTTCAACATGAATTTTGGGTGG - Intronic
1019221038 6:170472998-170473020 TTTTTAAAATTGATTTTGGCCGG - Intergenic
1019650223 7:2152841-2152863 ATTTTCACACTGGCATTGGGAGG + Intronic
1019902782 7:4036603-4036625 ATTTTCACACACATTTTGGAGGG - Intronic
1020736871 7:11961127-11961149 ATTTTAACCCAGATTTTGACTGG - Intergenic
1020944280 7:14581684-14581706 ATATGTACACTGATTTTGAGGGG - Intronic
1022222118 7:28323688-28323710 ATTTTTCCACGGACTTTGGGTGG + Intronic
1023533676 7:41185437-41185459 AAATTAAGACTGATTTTGGAGGG + Intergenic
1024706271 7:51963859-51963881 ATTTTCACATTGATTTTGCTGGG - Intergenic
1027278554 7:76588085-76588107 ATTTCAACATATATTTTGGGAGG + Intergenic
1028083942 7:86614161-86614183 ATTTCAACATGAATTTTGGGAGG - Intergenic
1028325262 7:89516569-89516591 ATTTTAATTCTGATTCTGGTAGG - Intergenic
1028918197 7:96283008-96283030 ATTTCAATATTTATTTTGGGTGG - Intronic
1029863306 7:103599000-103599022 ATTTTAACCTAGAATTTGGGGGG - Intronic
1030951553 7:115796553-115796575 ATTTTATCAGTTTTTTTGGGGGG + Intergenic
1032473896 7:132199431-132199453 TTTTTGACACTGATTTAGGAGGG - Intronic
1032869054 7:135961323-135961345 ATTCTAAAACTATTTTTGGGAGG - Intronic
1032876420 7:136043446-136043468 ATGATAACATGGATTTTGGGGGG - Intergenic
1033806326 7:144958409-144958431 ATTTTTACTTTAATTTTGGGTGG + Intergenic
1033832700 7:145272687-145272709 ATTTTAACACTAATTTTGGGAGG - Intergenic
1033973095 7:147067403-147067425 ATTTCAACATGAATTTTGGGAGG + Intronic
1035213453 7:157346543-157346565 TTTTAAACACTGTTTTTGAGAGG + Intronic
1035326418 7:158068917-158068939 ATTTTAGCACTGATTAAAGGTGG - Intronic
1036540861 8:9708631-9708653 ATTTTTAAACTTAGTTTGGGGGG + Intronic
1037072592 8:14670314-14670336 AATTTTACTCTGATTTGGGGGGG - Intronic
1037871128 8:22497527-22497549 GTTTTATCATTGATTTTGGGGGG + Intronic
1038284849 8:26197593-26197615 ATTTCAACACATATTTTGGGAGG + Intergenic
1038731624 8:30133043-30133065 ATTTTAAGATTTATTTTGTGTGG - Intronic
1038927995 8:32161625-32161647 ATTAAAACACTGAGATTGGGAGG - Intronic
1039237519 8:35518023-35518045 ATTTCAACATGAATTTTGGGGGG + Intronic
1039316283 8:36376234-36376256 ATTTTTACAATGATCTTGAGAGG + Intergenic
1039688894 8:39840565-39840587 TTTTTAAAACTCATTTAGGGAGG + Intergenic
1041169517 8:55127170-55127192 GTTTTAACACTTCTTTTGGGGGG - Intronic
1041359318 8:57034594-57034616 ATTTAAAAACAGATTTTGTGTGG + Intergenic
1041678835 8:60565521-60565543 ATTTTAAAACTGATTTCCTGTGG - Intronic
1042273058 8:66975348-66975370 CTTTAAACATTGTTTTTGGGCGG + Intronic
1042562895 8:70086523-70086545 AATTTAAAAAAGATTTTGGGGGG - Intergenic
1042590639 8:70394558-70394580 ATTTTGAGACTTATTTTGTGTGG - Intronic
1042688299 8:71465741-71465763 ATTTCAACACGAATTTTGGAGGG - Intronic
1042880202 8:73479239-73479261 ATTTGAACACTGATGTTTGATGG - Intronic
1043162024 8:76857514-76857536 ATTTTAACTTTTAGTTTGGGAGG + Intronic
1043190056 8:77209011-77209033 CTTTTAATACTGATTTTGTGAGG + Intergenic
1043733743 8:83718469-83718491 CTGTTGACACTGTTTTTGGGAGG - Intergenic
1046612651 8:116443056-116443078 ATTTTAACTCTGAAATTTGGAGG + Intergenic
1046925610 8:119784505-119784527 AAATTAACACTGATTTTGAAGGG + Intronic
1051731104 9:20143791-20143813 ATATTAACATTGCTTGTGGGTGG + Intergenic
1052273486 9:26652196-26652218 ATTTTAACATGAATTTTGGGTGG - Intergenic
1052515217 9:29471915-29471937 ATTTTAACAAGGATTTTGTGGGG + Intergenic
1052671819 9:31567617-31567639 ATCCTAACACTAGTTTTGGGAGG - Intergenic
1052689260 9:31795812-31795834 ATTTGCAAACTGAATTTGGGAGG + Intergenic
1053918740 9:42967025-42967047 ATCTTAACCCTGTTTTTGAGAGG + Intergenic
1055101338 9:72468724-72468746 ATTTTATCCCTGATTTTCTGAGG - Intergenic
1055354284 9:75421365-75421387 ATTTTAACATGAATTTTGGGAGG + Intergenic
1055687382 9:78791277-78791299 TTTTGATCACTGATTTTGGATGG + Intergenic
1055828314 9:80353104-80353126 ATTTTAACCCTGCTTCTGAGAGG + Intergenic
1056058043 9:82849573-82849595 ATTTTAAAAATGATTTTTGAAGG + Intergenic
1056240076 9:84636578-84636600 ATTTTAACAGTGAGTTCTGGAGG - Intergenic
1056254571 9:84785777-84785799 ATTTGAAAACTGTTCTTGGGAGG + Intronic
1056794044 9:89644805-89644827 ATTTTAATACGAATTTTAGGGGG - Intergenic
1057247225 9:93466905-93466927 TTGTTAACACAGATTCTGGGAGG + Intronic
1057640190 9:96812228-96812250 ATTTTAACAAGGATTCTGAGAGG - Intergenic
1058867739 9:109177081-109177103 ATTTTAAAACTGATTTTATGGGG + Intronic
1060136565 9:121161203-121161225 ATTGTAAAAGTGATTTGGGGTGG + Intronic
1061685988 9:132278772-132278794 ATTTTAACAATTATTTCTGGGGG + Intronic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1185945866 X:4375533-4375555 ATTTTAAAAATTATTTTTGGGGG - Intergenic
1186044722 X:5523056-5523078 TTTTTATCATTGATTTTGGCTGG + Intergenic
1186328587 X:8507810-8507832 TTTTTAATCCTGATTTTGGCAGG - Intergenic
1187490201 X:19744278-19744300 TTTTTTTCATTGATTTTGGGTGG + Intronic
1187790617 X:22946199-22946221 ATTTTAACATGAATTTTGGGAGG - Intergenic
1187828371 X:23355527-23355549 ATTTTAACAATTATTTTAAGTGG + Intronic
1187957284 X:24531967-24531989 ATTAAAATACTGATTTTGGCCGG + Intronic
1188337399 X:28954174-28954196 ATTTTAAAACTCATTTTGAAGGG - Intronic
1188429850 X:30094226-30094248 ATTTAATCACTGATTTTTGAAGG + Intergenic
1188767990 X:34120866-34120888 ATTTTAAAATTCACTTTGGGAGG + Intergenic
1188962207 X:36506523-36506545 ATTTTAAAACTGCCATTGGGTGG - Intergenic
1189526405 X:41826771-41826793 ATTTTAAAACTAATCTTGGCTGG - Intronic
1189979805 X:46498020-46498042 ATTATATCAGTGATTCTGGGTGG - Exonic
1191934971 X:66417617-66417639 GTGTTTACAATGATTTTGGGAGG + Intergenic
1192296293 X:69852383-69852405 ATTTTAAAAATCACTTTGGGAGG - Intronic
1193317659 X:80082522-80082544 AGTTTAACCCTGAACTTGGGAGG + Intergenic
1194314414 X:92357417-92357439 ATTTTAACATGAATTTTGGTAGG - Intronic
1194425320 X:93730519-93730541 ATTTTAGTCATGATTTTGGGGGG + Intergenic
1194524352 X:94959391-94959413 ATATTGACACTTTTTTTGGGGGG + Intergenic
1195089268 X:101442815-101442837 ATTTCAACACAAATTTTGGAGGG - Intronic
1195204985 X:102589376-102589398 ATTATAACACTGTATTTTGGGGG - Intergenic
1195832974 X:109080569-109080591 ATTTTAAAACTTATTTGGGAAGG - Intergenic
1196084362 X:111668375-111668397 ATTTAGAAACTGATTTTGGGAGG + Intronic
1198490684 X:137138109-137138131 ATTTTAACATTTATTTAGAGAGG + Intergenic
1199856213 X:151760919-151760941 ACTTAAACACTGATTTTCGATGG - Intergenic
1200150514 X:153949150-153949172 ATTTTACCATTGCTGTTGGGAGG - Exonic
1200183761 X:154168386-154168408 ATTTCAACACGAGTTTTGGGGGG - Intergenic
1200189415 X:154205514-154205536 ATTTCAACACGAGTTTTGGGGGG - Intergenic
1200195168 X:154243323-154243345 ATTTCAACACGAGTTTTGGGGGG - Intergenic
1200200820 X:154280444-154280466 ATTTCAACACGAGTTTTGGGGGG - Intronic
1200622472 Y:5468947-5468969 ATTTTAACATGAATTTTGGTAGG - Intronic
1201272525 Y:12268972-12268994 ATTTTAAAATTGATTTTCTGAGG + Intergenic
1201433718 Y:13933134-13933156 TTTTTAATCCTGATTTTGGCAGG + Intergenic
1201926527 Y:19293757-19293779 ATTTTCACACTGATGATGAGGGG + Intergenic