ID: 979284725

View in Genome Browser
Species Human (GRCh38)
Location 4:118909526-118909548
Sequence CCACATTAGCACCTGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979284725_979284730 -4 Left 979284725 4:118909526-118909548 CCAGAGTCCAGGTGCTAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 979284730 4:118909545-118909567 GTGGGACACAGCACTGTGGAAGG 0: 1
1: 0
2: 4
3: 27
4: 297
979284725_979284729 -8 Left 979284725 4:118909526-118909548 CCAGAGTCCAGGTGCTAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 979284729 4:118909541-118909563 TAATGTGGGACACAGCACTGTGG No data
979284725_979284731 -3 Left 979284725 4:118909526-118909548 CCAGAGTCCAGGTGCTAATGTGG 0: 1
1: 0
2: 2
3: 8
4: 113
Right 979284731 4:118909546-118909568 TGGGACACAGCACTGTGGAAGGG 0: 1
1: 0
2: 2
3: 38
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979284725 Original CRISPR CCACATTAGCACCTGGACTC TGG (reversed) Intronic
904118085 1:28176855-28176877 TCACCTTAGCTCCTGGCCTCGGG - Exonic
904342631 1:29846736-29846758 CCACAGCATCACCTGGCCTCAGG + Intergenic
904554350 1:31348617-31348639 CCAGACTAGCAGCTGGTCTCAGG - Intronic
906565748 1:46799860-46799882 CCACCTTAGCCCCTGCTCTCAGG + Intronic
907468096 1:54652932-54652954 CCAGGTTAGCCCCTGGACTCAGG - Exonic
908896062 1:68900839-68900861 CCACTCTAGCACTTGGAGTCTGG + Intergenic
910236023 1:85037398-85037420 CCACAATTACACCTGGACTCTGG - Intronic
912354102 1:109041570-109041592 CCACATTACCAGTTGGATTCTGG - Intronic
915849094 1:159302125-159302147 CCACATATACACCTGGAATCTGG - Intronic
918066016 1:181102216-181102238 CCTCATTAGGACTTGAACTCTGG - Intergenic
1062786357 10:268558-268580 CCTGATTAGCCTCTGGACTCAGG - Intergenic
1064273560 10:13886412-13886434 CTGCATTAGGACCAGGACTCCGG + Intronic
1064712903 10:18144519-18144541 CTCCATGAGCACCTGGACTTTGG - Intronic
1065664267 10:28041060-28041082 CAACATGAGCACCTTGAATCAGG + Intergenic
1069671000 10:70203812-70203834 CCACATTCCCACCTGGCCACAGG - Intronic
1069787702 10:70999227-70999249 CCTCATTCGCACCTGGAGTAAGG - Intergenic
1072714681 10:97742892-97742914 ACACATTAGCACCTGGGGTGAGG - Intronic
1073550516 10:104396285-104396307 CCACATTAGAGCCTGGCTTCAGG + Intronic
1074248056 10:111714204-111714226 CCACATTTGCAGCTGCACCCAGG + Intergenic
1075987481 10:126800183-126800205 CCAGATTAGCATCTGGATTTAGG - Intergenic
1080682461 11:34489394-34489416 CCACATTTCCTCCTGGCCTCTGG + Intronic
1084152828 11:67299199-67299221 CCAGAGTAGCCCCTGGGCTCTGG + Intronic
1088096214 11:106104133-106104155 CCACATTATGAGATGGACTCAGG - Intergenic
1088383558 11:109223611-109223633 CCAAATTAGAACATGGACACAGG - Intergenic
1089790836 11:120942357-120942379 CCACATTGACCCCTGGAGTCGGG + Intronic
1092141857 12:6189489-6189511 GCAGCTTAGCACCTGGGCTCTGG + Intergenic
1095918472 12:47504685-47504707 CCAGAGTACCACCTGGCCTCTGG + Intergenic
1098280382 12:68856394-68856416 CCACATCACCACCTGGAATCAGG - Exonic
1099959786 12:89385876-89385898 CCACTCAAGCACCTGGCCTCTGG + Intergenic
1104973192 12:132540692-132540714 ACACATCAGCACCTGGAACCAGG + Intronic
1113507693 13:110828408-110828430 CCACAGAAGCCCCTAGACTCTGG + Intergenic
1119902843 14:78276001-78276023 ACACATTATCACCTGGCCCCTGG - Intronic
1131987981 15:98064318-98064340 CCAAAATAGCACCAGGTCTCTGG - Intergenic
1132809118 16:1789301-1789323 ACACATCAGCACCTGGGCCCAGG - Intronic
1135067267 16:19320907-19320929 CAACATTAGCACTTGGACTTTGG + Intronic
1136075908 16:27817160-27817182 CCACATTCGGCCCTGGAATCAGG - Intronic
1137669145 16:50269289-50269311 CCACATTTGAGCCTGGAGTCAGG + Intronic
1138153313 16:54679306-54679328 CCATATTAGCAGATTGACTCAGG + Intergenic
1141981036 16:87550687-87550709 CCCCATAAGCACGTGGACTGGGG - Intergenic
1142299125 16:89246630-89246652 CAACATGAGCACATGGACACAGG + Intergenic
1145901679 17:28494102-28494124 CCAGGTAAGCACCTGGACTGGGG + Exonic
1149025907 17:52027230-52027252 TCACATTACCACCTGAGCTCTGG - Intronic
1152808070 17:82366932-82366954 CAACAATAGCACCAGGTCTCTGG - Intergenic
1154378397 18:13827698-13827720 CAGAATTAGCACCTGAACTCGGG - Intergenic
1155095663 18:22553361-22553383 CAACATTTGCATCTAGACTCAGG - Intergenic
1155946440 18:31857623-31857645 CCACATTGGCAGCTGCACTGAGG + Exonic
1159079166 18:63716205-63716227 CCTCTTTAGCAAGTGGACTCAGG - Intronic
1159132225 18:64292011-64292033 CCACATGAGCACTGAGACTCAGG - Intergenic
1159716090 18:71825142-71825164 CCACAGTAGCACAGGGACTGAGG - Intergenic
1161548248 19:4895578-4895600 CCGCCTCTGCACCTGGACTCGGG + Intronic
1161773308 19:6243060-6243082 CAAGATCAGCAGCTGGACTCAGG - Intronic
1161952501 19:7475713-7475735 CCACATGACCACCTGGTCACAGG - Intergenic
1164465845 19:28486938-28486960 CCTCATGAGAACCTGGAATCAGG - Intergenic
1165376581 19:35447179-35447201 CCACATGGGCACGTGAACTCGGG + Intronic
925046343 2:775395-775417 CCAAATCAGCACCTGGAATAAGG + Intergenic
929686218 2:44037364-44037386 TCACATTAGCTCCTGGAGACTGG + Intergenic
932783452 2:74578605-74578627 CCACATCTGCATCTGGGCTCTGG - Intronic
937452224 2:122011067-122011089 CCTCATTAGAACATGGGCTCTGG - Intergenic
937785889 2:125897300-125897322 CCACATTAGCTTATGGACTCAGG + Intergenic
937825300 2:126362345-126362367 CCACACTAGAACCAGGCCTCTGG - Intergenic
940653195 2:156457762-156457784 CCACATTTGCACGTGGAATTGGG - Intronic
942795511 2:179814205-179814227 CCTCATTGGCACCTGGCCTTGGG + Intronic
944164554 2:196704744-196704766 CAACATCAACACCTGGACACAGG - Intronic
947236062 2:227942246-227942268 CCACATCAACACATGGTCTCAGG + Intergenic
1172776671 20:37411486-37411508 CCACACTCACACCTGGACTGTGG - Intergenic
1173500542 20:43549640-43549662 CCACATCAGCACCTGGACACGGG - Intronic
1178931003 21:36819190-36819212 TCAGATTGCCACCTGGACTCAGG + Intronic
1182087446 22:27571045-27571067 CCCCATTAGACCTTGGACTCTGG + Intergenic
1183621161 22:38973598-38973620 CCAGAATAGAACCTGGACCCAGG + Intronic
1184246987 22:43240802-43240824 GCACATTGGCTCCTGGATTCGGG - Intronic
950460016 3:13115621-13115643 ACACACTGGCACCTGGGCTCAGG + Intergenic
952808637 3:37381476-37381498 CCTCATTAACACCTGGAGTTGGG + Intergenic
968673860 4:1866515-1866537 CCACAGCAGCACCTGGAGTTGGG + Intergenic
968869034 4:3232066-3232088 CCACATCAGGACCTGCTCTCGGG - Intronic
969096937 4:4740253-4740275 CCAGATGAGCTCCTGGACTTTGG + Intergenic
969700095 4:8763143-8763165 CCACATCAGCACTTGTGCTCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971844578 4:31902950-31902972 CCACATTACCACTCTGACTCTGG + Intergenic
972721968 4:41708815-41708837 CCTCCTTAGCTCCTGGCCTCTGG + Intergenic
975717170 4:77216334-77216356 GCACAAAAGCACCAGGACTCTGG + Intronic
978736077 4:112086031-112086053 CCACATTGGGATCTGGAGTCTGG + Intergenic
979284725 4:118909526-118909548 CCACATTAGCACCTGGACTCTGG - Intronic
985898476 5:2765174-2765196 CCACATCAGCACCTGCACTCTGG + Intergenic
987712194 5:21514867-21514889 CCACATCATCACCAGGACTGTGG - Intergenic
988302217 5:29445919-29445941 CCACATGATCACCAGGACTGTGG + Intergenic
990130129 5:52571330-52571352 GCACATAATCACCTGGATTCTGG - Intergenic
991762554 5:69934003-69934025 CCACATCATCACCAGGACTGTGG - Intergenic
991784771 5:70184103-70184125 CCACATCATCACCAGGACTGTGG + Intergenic
991841782 5:70809053-70809075 CCACATCATCACCAGGACTGTGG - Intergenic
991877219 5:71184496-71184518 CCACATCATCACCAGGACTGTGG + Intergenic
992533212 5:77671950-77671972 CCACTTTACCTCCAGGACTCTGG + Intergenic
993616822 5:90122956-90122978 CCAAAATAGCACCTGGGCTCAGG - Intergenic
997430341 5:133834193-133834215 CCCCATTAGCACAGGGTCTCTGG - Intergenic
1000756322 5:165165244-165165266 CCACATTATGGCCAGGACTCTGG - Intergenic
1001641257 5:173245785-173245807 CCGCATTAGGACCTAGACTGGGG + Intergenic
1002780006 6:358592-358614 GCCCATTAGGACCTGGACCCTGG + Intergenic
1004975847 6:20965217-20965239 CCAGATTATCACTTGGACCCAGG + Intronic
1007801400 6:44396886-44396908 GGACATAAGCACCTGCACTCAGG - Intronic
1009005513 6:57781828-57781850 CCACATCATCACCAGGACTGTGG + Intergenic
1012500624 6:99884294-99884316 CCACATTCACCCCTGGACACAGG + Intergenic
1012646776 6:101694116-101694138 CCACATCTGCATCTGGACTGTGG + Intronic
1015087057 6:129308314-129308336 CCACCATATCACTTGGACTCAGG + Intronic
1019023306 6:168937322-168937344 CCACCTGAGCAGCTGGCCTCCGG + Intergenic
1019124715 6:169830625-169830647 CCCCCTAGGCACCTGGACTCAGG + Intergenic
1028127085 7:87125862-87125884 CCACATTACCCACTGGACTTTGG + Intergenic
1032134096 7:129258803-129258825 CCAGATTAGCAACTGGAGACAGG + Intronic
1035300941 7:157896836-157896858 CCTCATTGAAACCTGGACTCCGG - Intronic
1036007204 8:4679239-4679261 TCACGTCAGCAGCTGGACTCAGG - Intronic
1042224659 8:66505688-66505710 CCACAAAAGCACCTGCTCTCAGG + Intronic
1042470632 8:69183452-69183474 CCAAATAACCACCTGGTCTCAGG - Intergenic
1047339164 8:123963640-123963662 CGACATGAGCACCTTCACTCAGG - Intronic
1047695551 8:127400348-127400370 CCACATTTGGCCCTGGAATCAGG - Intergenic
1048409699 8:134159753-134159775 CCACAGTAGGACTTGAACTCAGG + Intergenic
1052135392 9:24903340-24903362 CTAAATTCGCACCTGGACTCAGG + Intergenic
1052168379 9:25362770-25362792 CCACAGTAGCATCAGGGCTCTGG - Intergenic
1057601730 9:96464083-96464105 CCACATCAGAGCCTGGACCCAGG - Intronic
1061468134 9:130799470-130799492 CTAGATTAGCACCTAGACTAGGG - Intronic
1062161527 9:135083000-135083022 CCACATTCCCAGCTGGACCCTGG + Intronic
1187141126 X:16594612-16594634 CCACATTAGCAAGTGGACTTGGG + Intronic
1190591222 X:52003731-52003753 CCCCATCAGCTCCTGGAATCAGG + Intergenic
1190944005 X:55073088-55073110 CCCCAGTAGCACCTGGAACCCGG - Intergenic
1194518561 X:94890278-94890300 CAACAATAGCCTCTGGACTCTGG - Intergenic
1198314205 X:135450376-135450398 CCACATGAGTACCTGCAGTCAGG + Intergenic
1199709796 X:150461030-150461052 CCCCATTGCCACCTGGCCTCTGG - Intronic